\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140622638:

Variant ID: vg0140622638 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 40622638
Reference Allele: CGAlternative Allele: TG,C
Primary Allele: CGSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCCATCCATGTGATGGGTAACACCTACTCTACTCTACAGTATAATACTAGTGTGGTACTGATACGGTGATTATATGCTGTACTATCATTATACTACTG[CG/TG,C]
GCCCTGTTTGGTTCTATGGACTAATGTTTAGCTCTCACATTTTAATTTTAAATTAGCCCTCAAGAATCCAAACAGGTGGGCTAATTTTGAGCTAATGTGA

Reverse complement sequence

TCACATTAGCTCAAAATTAGCCCACCTGTTTGGATTCTTGAGGGCTAATTTAAAATTAAAATGTGAGAGCTAAACATTAGTCCATAGAACCAAACAGGGC[CG/CA,G]
CAGTAGTATAATGATAGTACAGCATATAATCACCGTATCAGTACCACACTAGTATTATACTGTAGAGTAGAGTAGGTGTTACCCATCACATGGATGGAGT

Allele Frequencies:

Populations Population SizeFrequency of CG(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.40% 0.02% 0.00% C: 0.04%
All Indica  2759 99.60% 0.30% 0.00% 0.00% C: 0.07%
All Japonica  1512 74.40% 25.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.00% 0.00% C: 0.25%
Temperate Japonica  767 63.00% 36.90% 0.13% 0.00% NA
Tropical Japonica  504 93.50% 6.50% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 29.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140622638 CG -> TG LOC_Os01g70180.1 upstream_gene_variant ; 3001.0bp to feature; MODIFIER silent_mutation Average:85.047; most accessible tissue: Zhenshan97 root, score: 97.082 N N N N
vg0140622638 CG -> TG LOC_Os01g70190.1 downstream_gene_variant ; 3373.0bp to feature; MODIFIER silent_mutation Average:85.047; most accessible tissue: Zhenshan97 root, score: 97.082 N N N N
vg0140622638 CG -> TG LOC_Os01g70180-LOC_Os01g70190 intergenic_region ; MODIFIER silent_mutation Average:85.047; most accessible tissue: Zhenshan97 root, score: 97.082 N N N N
vg0140622638 CG -> C LOC_Os01g70180.1 upstream_gene_variant ; 3002.0bp to feature; MODIFIER silent_mutation Average:85.047; most accessible tissue: Zhenshan97 root, score: 97.082 N N N N
vg0140622638 CG -> C LOC_Os01g70190.1 downstream_gene_variant ; 3372.0bp to feature; MODIFIER silent_mutation Average:85.047; most accessible tissue: Zhenshan97 root, score: 97.082 N N N N
vg0140622638 CG -> C LOC_Os01g70180-LOC_Os01g70190 intergenic_region ; MODIFIER silent_mutation Average:85.047; most accessible tissue: Zhenshan97 root, score: 97.082 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0140622638 CG C 0.05 0.03 0.05 0.02 -0.03 -0.04
vg0140622638 CG TG -0.01 0.01 0.0 0.05 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140622638 NA 1.27E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 NA 7.74E-06 mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 1.22E-06 NA mr1549 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 NA 2.91E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 NA 1.04E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 NA 2.98E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 NA 9.30E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 NA 3.00E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 2.02E-08 NA mr1757 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140622638 NA 6.21E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251