\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140621718:

Variant ID: vg0140621718 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40621718
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTGCAGACAGGAGGAGGGGGGCAAAACGACGAGGGTTTTTTTTTTCCTTCACAGTGTAGATCTCGTTCTTTTCTCAGAGTCTAACAGTTCGGTGTAAT[G/T]
GTGGGATGAAAATGTATGTGACATGAGTCTCTAGTTAAGACAATGTAGCGTACGATTTCTGCGTAGCCACGTTCTAAAAATAGATACGATTCGGAGTGGA

Reverse complement sequence

TCCACTCCGAATCGTATCTATTTTTAGAACGTGGCTACGCAGAAATCGTACGCTACATTGTCTTAACTAGAGACTCATGTCACATACATTTTCATCCCAC[C/A]
ATTACACCGAACTGTTAGACTCTGAGAAAAGAACGAGATCTACACTGTGAAGGAAAAAAAAAACCCTCGTCGTTTTGCCCCCCTCCTCCTGTCTGCACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.50% 11.40% 0.06% 0.00% NA
All Indica  2759 95.00% 5.00% 0.04% 0.00% NA
All Japonica  1512 74.10% 25.90% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.60% 0.13% 0.00% NA
Temperate Japonica  767 88.00% 12.00% 0.00% 0.00% NA
Tropical Japonica  504 62.90% 37.10% 0.00% 0.00% NA
Japonica Intermediate  241 53.10% 46.50% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140621718 G -> T LOC_Os01g70180.1 upstream_gene_variant ; 2081.0bp to feature; MODIFIER silent_mutation Average:85.354; most accessible tissue: Callus, score: 97.085 N N N N
vg0140621718 G -> T LOC_Os01g70180.2 upstream_gene_variant ; 4489.0bp to feature; MODIFIER silent_mutation Average:85.354; most accessible tissue: Callus, score: 97.085 N N N N
vg0140621718 G -> T LOC_Os01g70190.1 downstream_gene_variant ; 4293.0bp to feature; MODIFIER silent_mutation Average:85.354; most accessible tissue: Callus, score: 97.085 N N N N
vg0140621718 G -> T LOC_Os01g70180-LOC_Os01g70190 intergenic_region ; MODIFIER silent_mutation Average:85.354; most accessible tissue: Callus, score: 97.085 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0140621718 G T -0.03 -0.04 -0.06 -0.05 -0.05 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140621718 NA 4.92E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 2.20E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 4.50E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 1.09E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 5.49E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 9.81E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 3.86E-08 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 5.19E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 8.79E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 3.47E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 5.57E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 7.79E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 1.34E-08 mr1531_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 1.32E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 8.39E-08 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140621718 NA 1.22E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251