\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140501355:

Variant ID: vg0140501355 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40501355
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCCAAGCCCGACTCCCCGCCCGCCGGCGTCGACCCCCCGCCGCCCAAGGAGGAGGCGAAGGCGGAGAAGGAGGGGGAGGGGGAGGAGCCGCAGTCGGG[G/T]
GGGCGGAAGCGCGGGCGGCGGAAGAAGGGGGAGGCGGAGAAGGAGAAGGAGAAGCCCCCGCCCGCCACCCCCACCATCGAGAGGCCCTCCAGGGAGAGGA

Reverse complement sequence

TCCTCTCCCTGGAGGGCCTCTCGATGGTGGGGGTGGCGGGCGGGGGCTTCTCCTTCTCCTTCTCCGCCTCCCCCTTCTTCCGCCGCCCGCGCTTCCGCCC[C/A]
CCCGACTGCGGCTCCTCCCCCTCCCCCTCCTTCTCCGCCTTCGCCTCCTCCTTGGGCGGCGGGGGGTCGACGCCGGCGGGCGGGGAGTCGGGCTTGGCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 43.20% 0.44% 0.00% NA
All Indica  2759 31.80% 67.50% 0.69% 0.00% NA
All Japonica  1512 98.80% 1.20% 0.00% 0.00% NA
Aus  269 50.20% 49.40% 0.37% 0.00% NA
Indica I  595 32.60% 66.40% 1.01% 0.00% NA
Indica II  465 13.10% 86.70% 0.22% 0.00% NA
Indica III  913 34.70% 64.70% 0.55% 0.00% NA
Indica Intermediate  786 38.80% 60.30% 0.89% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140501355 G -> T LOC_Os01g70020.1 synonymous_variant ; p.Gly37Gly; LOW synonymous_codon Average:95.205; most accessible tissue: Zhenshan97 flower, score: 98.381 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0140501355 G T 0.0 -0.01 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140501355 NA 1.10E-06 mr1263 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 NA 4.85E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 5.20E-06 5.20E-06 mr1293 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 4.87E-06 4.87E-06 mr1294 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 1.41E-06 1.41E-06 mr1315 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 NA 1.10E-06 mr1451 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 4.61E-06 4.61E-06 mr1494 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 NA 7.46E-06 mr1636 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 NA 2.39E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 5.49E-07 5.49E-07 mr1681 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 2.47E-06 2.47E-06 mr1700 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 NA 3.09E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 NA 3.07E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 3.91E-06 3.91E-06 mr1810 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 1.59E-06 1.59E-06 mr1814 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 1.20E-06 1.20E-06 mr1854 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 NA 9.90E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355 NA 2.70E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251