Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0140501355:

Variant ID: vg0140501355 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40501355
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

ACGCCAAGCCCGACTCCCCGCCCGCCGGCGTCGACCCCCCGCCGCCCAAGGAGGAGGCGAAGGCGGAGAAGGAGGGGGAGGGGGAGGAGCCGCAGTCGGG[G/T]
GGGCGGAAGCGCGGGCGGCGGAAGAAGGGGGAGGCGGAGAAGGAGAAGGAGAAGCCCCCGCCCGCCACCCCCACCATCGAGAGGCCCTCCAGGGAGAGGA

Reverse complement sequence

TCCTCTCCCTGGAGGGCCTCTCGATGGTGGGGGTGGCGGGCGGGGGCTTCTCCTTCTCCTTCTCCGCCTCCCCCTTCTTCCGCCGCCCGCGCTTCCGCCC[C/A]
CCCGACTGCGGCTCCTCCCCCTCCCCCTCCTTCTCCGCCTTCGCCTCCTCCTTGGGCGGCGGGGGGTCGACGCCGGCGGGCGGGGAGTCGGGCTTGGCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.30%	43.20%	0.44%	0.00%	NA
All Indica	2759	31.80%	67.50%	0.69%	0.00%	NA
All Japonica	1512	98.80%	1.20%	0.00%	0.00%	NA
Aus	269	50.20%	49.40%	0.37%	0.00%	NA
Indica I	595	32.60%	66.40%	1.01%	0.00%	NA
Indica II	465	13.10%	86.70%	0.22%	0.00%	NA
Indica III	913	34.70%	64.70%	0.55%	0.00%	NA
Indica Intermediate	786	38.80%	60.30%	0.89%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140501355	G -> T	LOC_Os01g70020.1	synonymous_variant ; p.Gly37Gly; LOW	synonymous_codon	Average:95.205; most accessible tissue: Zhenshan97 flower, score: 98.381	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0140501355	G	T	0.0	-0.01	0.0	0.0	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140501355	NA	1.10E-06	mr1263	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	NA	4.85E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	5.20E-06	5.20E-06	mr1293	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	4.87E-06	4.87E-06	mr1294	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	1.41E-06	1.41E-06	mr1315	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	NA	1.10E-06	mr1451	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	4.61E-06	4.61E-06	mr1494	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	NA	7.46E-06	mr1636	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	NA	2.39E-06	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	5.49E-07	5.49E-07	mr1681	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	2.47E-06	2.47E-06	mr1700	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	NA	3.09E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	NA	3.07E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	3.91E-06	3.91E-06	mr1810	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	1.59E-06	1.59E-06	mr1814	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	1.20E-06	1.20E-06	mr1854	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	NA	9.90E-06	mr1888	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140501355	NA	2.70E-06	mr1976	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251