\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140000565:

Variant ID: vg0140000565 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40000565
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTCTCACCAGCGCTCGACGCCAACTGACGCCATTGCATCCATTCCAAAATCCGATCAATCCAGCGAGATAGTTAGCGATGCCCACTCCGGTGGCCGCC[A/G]
CGAGGCAGCGCTTCTCGTTGGCCGCCGTCCCCACCCTCGACGCCGCAGCCGCGTCCACGCACAGACCACCTCATCTCCTCCCTCCTCACCCCGCCCACGC

Reverse complement sequence

GCGTGGGCGGGGTGAGGAGGGAGGAGATGAGGTGGTCTGTGCGTGGACGCGGCTGCGGCGTCGAGGGTGGGGACGGCGGCCAACGAGAAGCGCTGCCTCG[T/C]
GGCGGCCACCGGAGTGGGCATCGCTAACTATCTCGCTGGATTGATCGGATTTTGGAATGGATGCAATGGCGTCAGTTGGCGTCGAGCGCTGGTGAGAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.20% 0.17% 0.00% NA
All Indica  2759 91.80% 8.00% 0.11% 0.00% NA
All Japonica  1512 7.50% 92.20% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.30% 2.50% 0.17% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 92.70% 7.30% 0.00% 0.00% NA
Indica Intermediate  786 83.20% 16.70% 0.13% 0.00% NA
Temperate Japonica  767 2.00% 97.70% 0.39% 0.00% NA
Tropical Japonica  504 15.10% 84.50% 0.40% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140000565 A -> G LOC_Os01g68840.1 upstream_gene_variant ; 1474.0bp to feature; MODIFIER silent_mutation Average:67.392; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0140000565 A -> G LOC_Os01g68840-LOC_Os01g68860 intergenic_region ; MODIFIER silent_mutation Average:67.392; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140000565 NA 8.90E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 2.69E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 3.84E-43 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 6.40E-32 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 1.94E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 9.59E-33 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 9.45E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 8.57E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 2.11E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 7.02E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 2.97E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 4.01E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 2.71E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 3.65E-09 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 1.70E-06 1.70E-06 mr1815 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 1.40E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 2.55E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 2.22E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 3.61E-37 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 8.75E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 5.07E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 4.82E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 2.55E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 2.91E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 1.54E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140000565 NA 5.65E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251