\
| Variant ID: vg0139981469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 39981469 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 112. )
GCTATATATAGTAGTTATTCTAATTCACATCGAATCGGATACGAGCGACATACAACCAGCTCAAAATCTGACTCAAACACGGATGACGTTCCAAAATTTT[G/A]
GCGAAAACATCTTCAATTTTTATATTTTTATTAATTATTAATTCATATGGTAGCTTTATACTAGCTCTATAGTTTTGTGATATATCGACTTAGATATGTG
CACATATCTAAGTCGATATATCACAAAACTATAGAGCTAGTATAAAGCTACCATATGAATTAATAATTAATAAAAATATAAAAATTGAAGATGTTTTCGC[C/T]
AAAATTTTGGAACGTCATCCGTGTTTGAGTCAGATTTTGAGCTGGTTGTATGTCGCTCGTATCCGATTCGATGTGAATTAGAATAACTACTATATATAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 38.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 7.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 2.20% | 97.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.50% | 14.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139981469 | G -> A | LOC_Os01g68820.1 | upstream_gene_variant ; 3754.0bp to feature; MODIFIER | silent_mutation | Average:48.892; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg0139981469 | G -> A | LOC_Os01g68810-LOC_Os01g68820 | intergenic_region ; MODIFIER | silent_mutation | Average:48.892; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139981469 | NA | 8.30E-66 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 1.68E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 4.55E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | 1.29E-06 | NA | mr1121 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 4.02E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 1.55E-22 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 3.93E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 5.94E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 6.53E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 7.35E-23 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 2.56E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 1.16E-36 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 6.10E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139981469 | NA | 1.64E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |