Variant ID: vg0139966622 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 39966622 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 354. )
AGATGTTCATAAAATACTTACATGATTGACTTATGAGATGTGTCAGGATGCAATATCAGATCATCACATGATACAGACTCCCCTTCTTCATTGTCATCCA[A/G]
AGGCCAATAGGTGTCACCTCCATTAGTGCTTTTGAAAAGTCTCATCACAGGTCGGTATATAAGAAAAGCAACCTAGATTGAAGTGAAAGTATTAGTACGC
GCGTACTAATACTTTCACTTCAATCTAGGTTGCTTTTCTTATATACCGACCTGTGATGAGACTTTTCAAAAGCACTAATGGAGGTGACACCTATTGGCCT[T/C]
TGGATGACAATGAAGAAGGGGAGTCTGTATCATGTGATGATCTGATATTGCATCCTGACACATCTCATAAGTCAATCATGTAAGTATTTTATGAACATCT
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.30% | 1.60% | 0.02% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 95.20% | 4.80% | 0.07% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 86.90% | 12.90% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0139966622 | A -> G | LOC_Os01g68810.1 | synonymous_variant ; p.Leu880Leu; LOW | synonymous_codon | Average:55.104; most accessible tissue: Minghui63 flower, score: 68.171 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0139966622 | NA | 3.29E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0139966622 | NA | 3.71E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0139966622 | NA | 9.74E-06 | mr1819_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0139966622 | NA | 3.68E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0139966622 | 4.21E-06 | 4.21E-06 | mr1885_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |