\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139946773:

Variant ID: vg0139946773 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39946773
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAACTGTTAAATGGTGTGATTTATGTAAAAAAAGTTGTTTAAAAAAATCATATCAATCCTTTTTTTAAAAAATAATTAATACTTAATTAATCATACAA[T/C]
AAAACAAACTTCGTTTTGCGTGCTAAGCAGCATGCGATCAGTGCACCATTAAACTAGTACTAATTTATTTTTGAAGCGAAACAAAGCATTTTGCAACCTC

Reverse complement sequence

GAGGTTGCAAAATGCTTTGTTTCGCTTCAAAAATAAATTAGTACTAGTTTAATGGTGCACTGATCGCATGCTGCTTAGCACGCAAAACGAAGTTTGTTTT[A/G]
TTGTATGATTAATTAAGTATTAATTATTTTTTAAAAAAAGGATTGATATGATTTTTTTAAACAACTTTTTTTACATAAATCACACCATTTAACAGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 4.50% 3.41% 0.72% NA
All Indica  2759 85.50% 7.70% 5.51% 1.23% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 98.50% 0.00% 1.49% 0.00% NA
Indica I  595 59.70% 20.70% 18.32% 1.34% NA
Indica II  465 99.40% 0.00% 0.65% 0.00% NA
Indica III  913 90.70% 6.20% 0.99% 2.08% NA
Indica Intermediate  786 91.00% 4.20% 3.94% 0.89% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 2.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139946773 T -> DEL N N silent_mutation Average:87.909; most accessible tissue: Zhenshan97 root, score: 96.605 N N N N
vg0139946773 T -> C LOC_Os01g68760.1 upstream_gene_variant ; 1885.0bp to feature; MODIFIER silent_mutation Average:87.909; most accessible tissue: Zhenshan97 root, score: 96.605 N N N N
vg0139946773 T -> C LOC_Os01g68770.1 upstream_gene_variant ; 1289.0bp to feature; MODIFIER silent_mutation Average:87.909; most accessible tissue: Zhenshan97 root, score: 96.605 N N N N
vg0139946773 T -> C LOC_Os01g68760-LOC_Os01g68770 intergenic_region ; MODIFIER silent_mutation Average:87.909; most accessible tissue: Zhenshan97 root, score: 96.605 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0139946773 T C -0.05 -0.02 -0.01 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139946773 4.73E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0139946773 2.52E-07 2.19E-14 Plant_height Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0139946773 NA 3.71E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 3.44E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 6.34E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 6.22E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 7.11E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 7.78E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 6.47E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 1.19E-07 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 1.17E-07 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 4.70E-07 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 2.41E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 3.77E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 3.32E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 8.74E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 6.43E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 4.21E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 3.31E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 5.41E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 5.27E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139946773 NA 1.19E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251