\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139831768:

Variant ID: vg0139831768 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39831768
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTACCTATTACTCCCACATAATAGGTGACGTTTTTGACTTTTTATTTGCAATGTTTGACCATTCATTTTATTTGAAAAATTAGTGCAAATATAAAAAAA[G/A,T]
ATAAGTCATATGTAAAGTACTTTTGATAATAAAGCAAATGACAAACAAAATAAATAATAATTTCAAAATTTTTTAAATAAGATGAATGATCAAACATTGA

Reverse complement sequence

TCAATGTTTGATCATTCATCTTATTTAAAAAATTTTGAAATTATTATTTATTTTGTTTGTCATTTGCTTTATTATCAAAAGTACTTTACATATGACTTAT[C/T,A]
TTTTTTTATATTTGCACTAATTTTTCAAATAAAATGAATGGTCAAACATTGCAAATAAAAAGTCAAAAACGTCACCTATTATGTGGGAGTAATAGGTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.50% 18.80% 0.68% 0.00% T: 0.02%
All Indica  2759 86.20% 13.40% 0.36% 0.00% NA
All Japonica  1512 66.50% 32.10% 1.39% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.00% T: 0.37%
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 70.10% 29.70% 0.22% 0.00% NA
Indica Intermediate  786 88.50% 10.80% 0.64% 0.00% NA
Temperate Japonica  767 93.00% 6.30% 0.78% 0.00% NA
Tropical Japonica  504 31.30% 66.90% 1.79% 0.00% NA
Japonica Intermediate  241 56.00% 41.50% 2.49% 0.00% NA
VI/Aromatic  96 89.60% 9.40% 1.04% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139831768 G -> T LOC_Os01g68560.1 upstream_gene_variant ; 3036.0bp to feature; MODIFIER silent_mutation Average:73.66; most accessible tissue: Callus, score: 97.891 N N N N
vg0139831768 G -> T LOC_Os01g68570.1 upstream_gene_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:73.66; most accessible tissue: Callus, score: 97.891 N N N N
vg0139831768 G -> T LOC_Os01g68580.1 upstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:73.66; most accessible tissue: Callus, score: 97.891 N N N N
vg0139831768 G -> T LOC_Os01g68570-LOC_Os01g68580 intergenic_region ; MODIFIER silent_mutation Average:73.66; most accessible tissue: Callus, score: 97.891 N N N N
vg0139831768 G -> A LOC_Os01g68560.1 upstream_gene_variant ; 3036.0bp to feature; MODIFIER silent_mutation Average:73.66; most accessible tissue: Callus, score: 97.891 N N N N
vg0139831768 G -> A LOC_Os01g68570.1 upstream_gene_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:73.66; most accessible tissue: Callus, score: 97.891 N N N N
vg0139831768 G -> A LOC_Os01g68580.1 upstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:73.66; most accessible tissue: Callus, score: 97.891 N N N N
vg0139831768 G -> A LOC_Os01g68570-LOC_Os01g68580 intergenic_region ; MODIFIER silent_mutation Average:73.66; most accessible tissue: Callus, score: 97.891 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0139831768 G A -0.02 -0.01 -0.01 -0.04 -0.02 0.0
vg0139831768 G T -0.01 -0.01 -0.01 -0.05 -0.03 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139831768 NA 2.28E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.40E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.10E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 3.32E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 7.29E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.23E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.01E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.52E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 7.49E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 3.92E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.89E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.06E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 3.99E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.71E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.35E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.02E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.01E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.05E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 9.95E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.09E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.66E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 7.41E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 3.23E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 3.94E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.25E-12 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.12E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.18E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.41E-10 mr1671_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 4.87E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.04E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 3.34E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 4.29E-12 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.00E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.20E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 6.50E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 6.02E-12 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 3.23E-07 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 1.50E-11 mr1862_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 6.41E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 NA 2.71E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139831768 1.44E-06 1.92E-06 mr1929_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251