Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0139810181:

Variant ID: vg0139810181 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 39810181
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTCGGCGGACGGACGCATATGTGTCCGTTTCGCAATAAACACACGGGAGCAATCGCATCACGCCGACCCAAAAAAAACCGTCCCGTCCGCTCCGCGGC[G/A]
CTTGACAACGCGTGGTGCACCCAATAGCTCTAGCGTGACAAGACTCCTACGCCGTCACGCACCCACGCACGCACGCACGCACGCATATATGTGCAGTGTA

Reverse complement sequence

TACACTGCACATATATGCGTGCGTGCGTGCGTGCGTGGGTGCGTGACGGCGTAGGAGTCTTGTCACGCTAGAGCTATTGGGTGCACCACGCGTTGTCAAG[C/T]
GCCGCGGAGCGGACGGGACGGTTTTTTTTGGGTCGGCGTGATGCGATTGCTCCCGTGTGTTTATTGCGAAACGGACACATATGCGTCCGTCCGCCGAAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	33.50%	0.04%	0.00%	NA
All Indica	2759	95.60%	4.40%	0.04%	0.00%	NA
All Japonica	1512	20.50%	79.50%	0.00%	0.00%	NA
Aus	269	49.80%	50.20%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	95.20%	4.80%	0.00%	0.00%	NA
Indica Intermediate	786	92.10%	7.80%	0.13%	0.00%	NA
Temperate Japonica	767	3.10%	96.90%	0.00%	0.00%	NA
Tropical Japonica	504	33.70%	66.30%	0.00%	0.00%	NA
Japonica Intermediate	241	48.10%	51.90%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	51.10%	47.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139810181	G -> A	LOC_Os01g68510.1	upstream_gene_variant ; 122.0bp to feature; MODIFIER	silent_mutation	Average:76.028; most accessible tissue: Callus, score: 98.034	N	N	N	N
vg0139810181	G -> A	LOC_Os01g68524.1	downstream_gene_variant ; 1541.0bp to feature; MODIFIER	silent_mutation	Average:76.028; most accessible tissue: Callus, score: 98.034	N	N	N	N
vg0139810181	G -> A	LOC_Os01g68524.2	downstream_gene_variant ; 1541.0bp to feature; MODIFIER	silent_mutation	Average:76.028; most accessible tissue: Callus, score: 98.034	N	N	N	N
vg0139810181	G -> A	LOC_Os01g68500-LOC_Os01g68510	intergenic_region ; MODIFIER	silent_mutation	Average:76.028; most accessible tissue: Callus, score: 98.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139810181	NA	1.85E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139810181	NA	5.28E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139810181	3.02E-07	3.01E-07	mr1065_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139810181	4.25E-06	1.56E-08	mr1091_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139810181	NA	2.71E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139810181	5.77E-06	3.40E-08	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139810181	NA	6.13E-06	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139810181	NA	2.27E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139810181	NA	4.80E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251