Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0139482357:

Variant ID: vg0139482357 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 39482357
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGGACCGGTTCGCGGGAAACCCTGAAAGAATTCCTCGTACTTGCCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTTTAGCTGA[T/C]
GCATCTAGGCAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGACGGCCTATGCAGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGC

Reverse complement sequence

GCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCTGCATAGGCCGTCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTGCCTAGATGC[A/G]
TCAGCTAAAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGCAAGTACGAGGAATTCTTTCAGGGTTTCCCGCGAACCGGTCCTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.20%	25.10%	0.57%	2.14%	NA
All Indica	2759	97.90%	0.90%	0.80%	0.40%	NA
All Japonica	1512	21.40%	74.50%	0.20%	3.97%	NA
Aus	269	97.80%	0.00%	0.00%	2.23%	NA
Indica I	595	97.80%	2.00%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.00%	0.00%	0.11%	0.88%	NA
Indica Intermediate	786	95.90%	1.10%	2.54%	0.38%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	36.50%	52.20%	0.40%	10.91%	NA
Japonica Intermediate	241	48.10%	49.40%	0.41%	2.07%	NA
VI/Aromatic	96	78.10%	1.00%	0.00%	20.83%	NA
Intermediate	90	55.60%	37.80%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139482357	T -> DEL	N	N	silent_mutation	Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482357	T -> C	LOC_Os01g67930.1	upstream_gene_variant ; 3695.0bp to feature; MODIFIER	silent_mutation	Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482357	T -> C	LOC_Os01g67940.1	upstream_gene_variant ; 1304.0bp to feature; MODIFIER	silent_mutation	Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482357	T -> C	LOC_Os01g67950.1	upstream_gene_variant ; 1398.0bp to feature; MODIFIER	silent_mutation	Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482357	T -> C	LOC_Os01g67960.1	upstream_gene_variant ; 4575.0bp to feature; MODIFIER	silent_mutation	Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0139482357	T -> C	LOC_Os01g67940-LOC_Os01g67950	intergenic_region ; MODIFIER	silent_mutation	Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139482357	NA	6.05E-18	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357	NA	7.07E-40	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357	NA	1.43E-27	mr1548	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357	NA	1.51E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357	NA	1.15E-16	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357	NA	6.71E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357	NA	1.07E-50	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357	NA	5.56E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357	NA	2.21E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251