\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139482357:

Variant ID: vg0139482357 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39482357
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGGACCGGTTCGCGGGAAACCCTGAAAGAATTCCTCGTACTTGCCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTTTAGCTGA[T/C]
GCATCTAGGCAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGACGGCCTATGCAGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGC

Reverse complement sequence

GCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCTGCATAGGCCGTCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTGCCTAGATGC[A/G]
TCAGCTAAAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGCAAGTACGAGGAATTCTTTCAGGGTTTCCCGCGAACCGGTCCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 25.10% 0.57% 2.14% NA
All Indica  2759 97.90% 0.90% 0.80% 0.40% NA
All Japonica  1512 21.40% 74.50% 0.20% 3.97% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 97.80% 2.00% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.00% 0.00% 0.11% 0.88% NA
Indica Intermediate  786 95.90% 1.10% 2.54% 0.38% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 36.50% 52.20% 0.40% 10.91% NA
Japonica Intermediate  241 48.10% 49.40% 0.41% 2.07% NA
VI/Aromatic  96 78.10% 1.00% 0.00% 20.83% NA
Intermediate  90 55.60% 37.80% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139482357 T -> DEL N N silent_mutation Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0139482357 T -> C LOC_Os01g67930.1 upstream_gene_variant ; 3695.0bp to feature; MODIFIER silent_mutation Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0139482357 T -> C LOC_Os01g67940.1 upstream_gene_variant ; 1304.0bp to feature; MODIFIER silent_mutation Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0139482357 T -> C LOC_Os01g67950.1 upstream_gene_variant ; 1398.0bp to feature; MODIFIER silent_mutation Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0139482357 T -> C LOC_Os01g67960.1 upstream_gene_variant ; 4575.0bp to feature; MODIFIER silent_mutation Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0139482357 T -> C LOC_Os01g67940-LOC_Os01g67950 intergenic_region ; MODIFIER silent_mutation Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139482357 NA 6.05E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357 NA 7.07E-40 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357 NA 1.43E-27 mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357 NA 1.51E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357 NA 1.15E-16 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357 NA 6.71E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357 NA 1.07E-50 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357 NA 5.56E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139482357 NA 2.21E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251