| Variant ID: vg0139482357 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 39482357 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAGGACCGGTTCGCGGGAAACCCTGAAAGAATTCCTCGTACTTGCCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTTTAGCTGA[T/C]
GCATCTAGGCAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGACGGCCTATGCAGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGC
GCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCTGCATAGGCCGTCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTGCCTAGATGC[A/G]
TCAGCTAAAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGCAAGTACGAGGAATTCTTTCAGGGTTTCCCGCGAACCGGTCCTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.20% | 25.10% | 0.57% | 2.14% | NA |
| All Indica | 2759 | 97.90% | 0.90% | 0.80% | 0.40% | NA |
| All Japonica | 1512 | 21.40% | 74.50% | 0.20% | 3.97% | NA |
| Aus | 269 | 97.80% | 0.00% | 0.00% | 2.23% | NA |
| Indica I | 595 | 97.80% | 2.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.00% | 0.11% | 0.88% | NA |
| Indica Intermediate | 786 | 95.90% | 1.10% | 2.54% | 0.38% | NA |
| Temperate Japonica | 767 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.50% | 52.20% | 0.40% | 10.91% | NA |
| Japonica Intermediate | 241 | 48.10% | 49.40% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 78.10% | 1.00% | 0.00% | 20.83% | NA |
| Intermediate | 90 | 55.60% | 37.80% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139482357 | T -> DEL | N | N | silent_mutation | Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482357 | T -> C | LOC_Os01g67930.1 | upstream_gene_variant ; 3695.0bp to feature; MODIFIER | silent_mutation | Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482357 | T -> C | LOC_Os01g67940.1 | upstream_gene_variant ; 1304.0bp to feature; MODIFIER | silent_mutation | Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482357 | T -> C | LOC_Os01g67950.1 | upstream_gene_variant ; 1398.0bp to feature; MODIFIER | silent_mutation | Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482357 | T -> C | LOC_Os01g67960.1 | upstream_gene_variant ; 4575.0bp to feature; MODIFIER | silent_mutation | Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0139482357 | T -> C | LOC_Os01g67940-LOC_Os01g67950 | intergenic_region ; MODIFIER | silent_mutation | Average:43.055; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139482357 | NA | 6.05E-18 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482357 | NA | 7.07E-40 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482357 | NA | 1.43E-27 | mr1548 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482357 | NA | 1.51E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482357 | NA | 1.15E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482357 | NA | 6.71E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482357 | NA | 1.07E-50 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482357 | NA | 5.56E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139482357 | NA | 2.21E-06 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |