\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138932968:

Variant ID: vg0138932968 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38932968
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCATATATGTTAGTTATGACATCGTAATTTCTAGTCTTCATACAGCTCCAGTTATTGAAATAAAAAGTTACCTTTTTGGCATGAACATCCTTAATCTT[G/A]
CGAGGAGGGAGGATGTCCCAGTCAGTGTACATGCTCCCTGATTCTCTTTCACGGTTATCAACTAGTATGCTATAGGACGCATCAGGCCTTAGTATGAATG

Reverse complement sequence

CATTCATACTAAGGCCTGATGCGTCCTATAGCATACTAGTTGATAACCGTGAAAGAGAATCAGGGAGCATGTACACTGACTGGGACATCCTCCCTCCTCG[C/T]
AAGATTAAGGATGTTCATGCCAAAAAGGTAACTTTTTATTTCAATAACTGGAGCTGTATGAAGACTAGAAATTACGATGTCATAACTAACATATATGCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 30.00% 0.15% 0.25% NA
All Indica  2759 99.20% 0.50% 0.14% 0.11% NA
All Japonica  1512 8.50% 91.00% 0.20% 0.33% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.20% 0.34% 0.34% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 4.20% 95.60% 0.00% 0.26% NA
Tropical Japonica  504 14.90% 84.50% 0.20% 0.40% NA
Japonica Intermediate  241 8.70% 90.00% 0.83% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138932968 G -> A LOC_Os01g67054.1 synonymous_variant ; p.Arg234Arg; LOW synonymous_codon Average:61.231; most accessible tissue: Callus, score: 82.131 N N N N
vg0138932968 G -> A LOC_Os01g67054.3 synonymous_variant ; p.Arg142Arg; LOW synonymous_codon Average:61.231; most accessible tissue: Callus, score: 82.131 N N N N
vg0138932968 G -> A LOC_Os01g67054.2 synonymous_variant ; p.Arg234Arg; LOW synonymous_codon Average:61.231; most accessible tissue: Callus, score: 82.131 N N N N
vg0138932968 G -> DEL LOC_Os01g67054.1 N frameshift_variant Average:61.231; most accessible tissue: Callus, score: 82.131 N N N N
vg0138932968 G -> DEL LOC_Os01g67054.2 N frameshift_variant Average:61.231; most accessible tissue: Callus, score: 82.131 N N N N
vg0138932968 G -> DEL LOC_Os01g67054.3 N frameshift_variant Average:61.231; most accessible tissue: Callus, score: 82.131 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0138932968 G A -0.02 -0.02 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138932968 5.15E-07 NA Grain_thickness All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138932968 NA 5.29E-54 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138932968 NA 6.47E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 3.94E-46 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 5.10E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 5.44E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 7.11E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 1.59E-82 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 1.00E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 1.25E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 4.72E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 2.24E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 4.30E-17 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 4.87E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968 NA 2.63E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251