\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138627461:

Variant ID: vg0138627461 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38627461
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTTATTTTAACAACCTATCATCTTAATGACTTTTTTGGATTTAATGCATGACTCTTTATTCTTCCATACAAGATTGGCTACATGGGCATCGAGAAAT[G/A]
TAAATATTAATGAATCGCTTGTTTACGAGAAATGACTAGTAGTATATTTAAATGGATGATAAGTAGAATTATTTATCTTTGGTCTATGTGTCAAGATGAA

Reverse complement sequence

TTCATCTTGACACATAGACCAAAGATAAATAATTCTACTTATCATCCATTTAAATATACTACTAGTCATTTCTCGTAAACAAGCGATTCATTAATATTTA[C/T]
ATTTCTCGATGCCCATGTAGCCAATCTTGTATGGAAGAATAAAGAGTCATGCATTAAATCCAAAAAAGTCATTAAGATGATAGGTTGTTAAAATAAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 3.20% 2.26% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 83.10% 9.90% 6.94% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 75.20% 13.30% 11.47% 0.00% NA
Tropical Japonica  504 93.70% 5.20% 1.19% 0.00% NA
Japonica Intermediate  241 86.30% 9.10% 4.56% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138627461 G -> A LOC_Os01g66500.1 upstream_gene_variant ; 3625.0bp to feature; MODIFIER silent_mutation Average:48.154; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0138627461 G -> A LOC_Os01g66510.1 upstream_gene_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:48.154; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0138627461 G -> A LOC_Os01g66520.1 downstream_gene_variant ; 3882.0bp to feature; MODIFIER silent_mutation Average:48.154; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0138627461 G -> A LOC_Os01g66500-LOC_Os01g66510 intergenic_region ; MODIFIER silent_mutation Average:48.154; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138627461 8.53E-06 NA mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138627461 2.46E-06 NA mr1152 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138627461 4.08E-06 NA mr1154 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138627461 5.92E-06 NA mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251