\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138349324:

Variant ID: vg0138349324 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38349324
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGAGCAAGTTGAGGTCTTGGAGAAGAAGAACGAAGAACTTGAACTCGCCTGCAAAAATCAAAGCGAGAAGATATCTGCTTTAGAGCTCGAGAGCGAAA[A/G]
TTGCCGCCAACTTCTTCTGAAAAGTTGCGAGACCGTTCGAATCGCGTTGCGAAGTCTAGGGGCTGACATCAGCTTGCTATCGGAAGAAAATACCTTAGCA

Reverse complement sequence

TGCTAAGGTATTTTCTTCCGATAGCAAGCTGATGTCAGCCCCTAGACTTCGCAACGCGATTCGAACGGTCTCGCAACTTTTCAGAAGAAGTTGGCGGCAA[T/C]
TTTCGCTCTCGAGCTCTAAAGCAGATATCTTCTCGCTTTGATTTTTGCAGGCGAGTTCAAGTTCTTCGTTCTTCTTCTCCAAGACCTCAACTTGCTCTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 0.40% 4.72% 57.55% NA
All Indica  2759 5.40% 0.60% 7.18% 86.77% NA
All Japonica  1512 97.20% 0.00% 0.07% 2.71% NA
Aus  269 2.20% 0.70% 6.69% 90.33% NA
Indica I  595 3.20% 0.50% 4.03% 92.27% NA
Indica II  465 8.40% 0.20% 6.24% 85.16% NA
Indica III  913 3.00% 1.40% 8.98% 86.64% NA
Indica Intermediate  786 8.30% 0.00% 8.02% 83.72% NA
Temperate Japonica  767 97.90% 0.00% 0.00% 2.09% NA
Tropical Japonica  504 96.80% 0.00% 0.00% 3.17% NA
Japonica Intermediate  241 95.90% 0.00% 0.41% 3.73% NA
VI/Aromatic  96 91.70% 0.00% 4.17% 4.17% NA
Intermediate  90 55.60% 0.00% 2.22% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138349324 A -> G LOC_Os01g66080.1 missense_variant ; p.Asn807Ser; MODERATE nonsynonymous_codon Average:5.065; most accessible tissue: Callus, score: 9.028 unknown unknown TOLERATED 0.58
vg0138349324 A -> DEL LOC_Os01g66080.1 N frameshift_variant Average:5.065; most accessible tissue: Callus, score: 9.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138349324 NA 4.22E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 2.29E-11 9.99E-95 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 1.34E-09 1.38E-11 mr1134 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 4.09E-06 4.33E-10 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 3.43E-12 4.64E-94 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 1.24E-07 6.98E-09 mr1135 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 6.64E-06 2.30E-09 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 1.05E-28 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 9.52E-06 9.52E-06 mr1375 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 1.22E-22 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 8.94E-10 2.09E-101 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 3.57E-07 1.84E-09 mr1504 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 2.04E-09 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 3.66E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 1.21E-06 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 1.30E-68 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 1.30E-07 2.19E-12 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 6.97E-39 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 3.49E-09 3.86E-94 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 3.30E-06 5.76E-08 mr1672 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 3.95E-98 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 4.90E-06 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 7.64E-09 3.45E-19 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 6.19E-90 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 6.10E-11 2.62E-21 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 1.56E-06 7.77E-11 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 2.87E-07 6.68E-15 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 2.97E-06 7.16E-51 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 1.13E-06 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138349324 NA 8.30E-10 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251