\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138169058:

Variant ID: vg0138169058 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38169058
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGCACGGCTGTTCGAACAGTTCATTAATCTCTGCAGAGGTTGCACGCTTTACCCACACGACACGAAACTGACATTGTTTACCCGTCAGCAACGAAAGTT[C/T]
GTGATAAGGCCTTTCCAAAGCTAACCCATGAAAATCGCATGCCACCTAGTTGGGCTAAAATCCATAGCCGAGTATCAGGCAATGACAACCGTCATCCACT

Reverse complement sequence

AGTGGATGACGGTTGTCATTGCCTGATACTCGGCTATGGATTTTAGCCCAACTAGGTGGCATGCGATTTTCATGGGTTAGCTTTGGAAAGGCCTTATCAC[G/A]
AACTTTCGTTGCTGACGGGTAAACAATGTCAGTTTCGTGTCGTGTGGGTAAAGCGTGCAACCTCTGCAGAGATTAATGAACTGTTCGAACAGCCGTGCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 23.00% 2.01% 0.00% NA
All Indica  2759 59.60% 37.30% 3.19% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 97.40% 0.40% 2.23% 0.00% NA
Indica I  595 52.40% 39.00% 8.57% 0.00% NA
Indica II  465 17.60% 81.10% 1.29% 0.00% NA
Indica III  913 88.10% 11.50% 0.44% 0.00% NA
Indica Intermediate  786 56.60% 39.90% 3.44% 0.00% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138169058 C -> T LOC_Os01g65740.1 downstream_gene_variant ; 1913.0bp to feature; MODIFIER silent_mutation Average:48.415; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0138169058 C -> T LOC_Os01g65750.1 downstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:48.415; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0138169058 C -> T LOC_Os01g65760.1 downstream_gene_variant ; 3712.0bp to feature; MODIFIER silent_mutation Average:48.415; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0138169058 C -> T LOC_Os01g65740-LOC_Os01g65750 intergenic_region ; MODIFIER silent_mutation Average:48.415; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138169058 NA 1.58E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 4.25E-07 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 8.39E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 2.05E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 2.59E-06 mr1056 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 1.74E-07 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 5.35E-07 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 1.64E-07 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 5.96E-08 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 8.10E-06 mr1574 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 4.51E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 9.96E-06 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138169058 NA 3.91E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251