\
| Variant ID: vg0138161446 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 38161446 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATAAAGACTCAAAGGATTTTTCCATGAGGTTCTACCTCTTGTTAAAATTCCTCCAAAACTTGAAATTCATAGGGTTCATTTCTTTGATTCAAAGGGCTT[T/C]
GTAGGAAAAATTCCTATAGGAATGAAATCCTCTAAGGGCCCCTTTGAATCAAAGGATTTATGTAGGAATTTCATAAATTCAAATTCTATAGAAAATTTTC
GAAAATTTTCTATAGAATTTGAATTTATGAAATTCCTACATAAATCCTTTGATTCAAAGGGGCCCTTAGAGGATTTCATTCCTATAGGAATTTTTCCTAC[A/G]
AAGCCCTTTGAATCAAAGAAATGAACCCTATGAATTTCAAGTTTTGGAGGAATTTTAACAAGAGGTAGAACCTCATGGAAAAATCCTTTGAGTCTTTATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0138161446 | T -> C | LOC_Os01g65730.1 | upstream_gene_variant ; 1661.0bp to feature; MODIFIER | silent_mutation | Average:24.846; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0138161446 | T -> C | LOC_Os01g65740.1 | upstream_gene_variant ; 3091.0bp to feature; MODIFIER | silent_mutation | Average:24.846; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0138161446 | T -> C | LOC_Os01g65720.1 | downstream_gene_variant ; 4335.0bp to feature; MODIFIER | silent_mutation | Average:24.846; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0138161446 | T -> C | LOC_Os01g65730-LOC_Os01g65740 | intergenic_region ; MODIFIER | silent_mutation | Average:24.846; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0138161446 | NA | 1.69E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 7.21E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | 3.41E-07 | NA | mr1134 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | 3.59E-06 | NA | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 1.47E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 8.65E-09 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 4.86E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | 5.51E-09 | NA | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 4.86E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 5.80E-06 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 9.85E-09 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 4.56E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 4.10E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0138161446 | NA | 8.59E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |