\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138144207:

Variant ID: vg0138144207 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38144207
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGATGTAGAGGTTGAATTTGAACTTGCATGTTTGTGGAGTGATATATCACATGTTAATACATCATCCCAAATTTTTTAAAATTTTTTCATAACCATTT[A/G]
AGTGACATGTAAACAAAAAGAGGGGACATCCCCTCGAGAAATCAAAATTCACTTCCACTATGTGAGCACTTACTGGATTAGAACTCTTGAGGGGAGATAA

Reverse complement sequence

TTATCTCCCCTCAAGAGTTCTAATCCAGTAAGTGCTCACATAGTGGAAGTGAATTTTGATTTCTCGAGGGGATGTCCCCTCTTTTTGTTTACATGTCACT[T/C]
AAATGGTTATGAAAAAATTTTAAAAAATTTGGGATGATGTATTAACATGTGATATATCACTCCACAAACATGCAAGTTCAAATTCAACCTCTACATCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.70% 0.04% 0.00% NA
All Indica  2759 98.30% 1.60% 0.04% 0.00% NA
All Japonica  1512 3.20% 96.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 4.80% 0.13% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138144207 A -> G LOC_Os01g65680.1 upstream_gene_variant ; 1512.0bp to feature; MODIFIER silent_mutation Average:25.539; most accessible tissue: Callus, score: 48.324 N N N N
vg0138144207 A -> G LOC_Os01g65700.1 upstream_gene_variant ; 4477.0bp to feature; MODIFIER silent_mutation Average:25.539; most accessible tissue: Callus, score: 48.324 N N N N
vg0138144207 A -> G LOC_Os01g65690.1 downstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:25.539; most accessible tissue: Callus, score: 48.324 N N N N
vg0138144207 A -> G LOC_Os01g65692.1 downstream_gene_variant ; 2814.0bp to feature; MODIFIER silent_mutation Average:25.539; most accessible tissue: Callus, score: 48.324 N N N N
vg0138144207 A -> G LOC_Os01g65690.2 downstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:25.539; most accessible tissue: Callus, score: 48.324 N N N N
vg0138144207 A -> G LOC_Os01g65680-LOC_Os01g65690 intergenic_region ; MODIFIER silent_mutation Average:25.539; most accessible tissue: Callus, score: 48.324 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138144207 NA 9.78E-28 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 NA 1.65E-45 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 3.11E-23 2.14E-114 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 2.80E-11 1.18E-16 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 6.76E-24 3.19E-113 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 1.19E-10 1.17E-14 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 NA 5.26E-45 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 7.63E-06 5.66E-31 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 9.99E-21 6.78E-125 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 2.56E-10 6.94E-17 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 NA 3.41E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 8.38E-10 3.75E-105 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 NA 5.13E-06 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 3.06E-10 1.17E-81 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 5.37E-08 2.22E-11 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 6.43E-14 2.47E-49 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 7.24E-08 7.25E-08 mr1670 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 3.95E-18 1.03E-113 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 5.29E-06 2.48E-08 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 1.11E-21 4.28E-125 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 5.31E-15 5.33E-30 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 NA 2.64E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 1.60E-16 1.09E-113 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 2.67E-13 9.97E-27 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 2.43E-12 2.97E-157 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 1.27E-06 5.43E-09 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 8.57E-16 2.38E-127 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 4.31E-11 3.42E-16 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 1.17E-06 1.16E-43 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 5.16E-12 5.58E-61 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 1.11E-20 6.50E-155 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138144207 NA 5.03E-13 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251