\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138075905:

Variant ID: vg0138075905 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38075905
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GGCATCAAATTTTAAAGAACCCATTAGGGGTATCCTCCATTGGAAGATGAGTTCCCCAGAGAATACCCTTAGTTAGTGAGAGCACTCTAGAGGTGGCTTC[G/A]
GTTGTATATGCCCTAAGTAGTGTCACTAGTACAAGCGTTACTACTCCAATGCCAAAACAAAGCATGGAAGGACAAACGCTAAGAGGTAAAGCGTTAAGCA

Reverse complement sequence

TGCTTAACGCTTTACCTCTTAGCGTTTGTCCTTCCATGCTTTGTTTTGGCATTGGAGTAGTAACGCTTGTACTAGTGACACTACTTAGGGCATATACAAC[C/T]
GAAGCCACCTCTAGAGTGCTCTCACTAACTAAGGGTATTCTCTGGGGAACTCATCTTCCAATGGAGGATACCCCTAATGGGTTCTTTAAAATTTGATGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 40.90% 0.13% 0.00% NA
All Indica  2759 95.30% 4.60% 0.14% 0.00% NA
All Japonica  1512 2.70% 97.20% 0.07% 0.00% NA
Aus  269 28.30% 71.70% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 95.90% 3.90% 0.11% 0.00% NA
Indica Intermediate  786 89.40% 10.20% 0.38% 0.00% NA
Temperate Japonica  767 2.70% 97.10% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138075905 G -> A LOC_Os01g65580.1 downstream_gene_variant ; 4213.0bp to feature; MODIFIER silent_mutation Average:75.925; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg0138075905 G -> A LOC_Os01g65590.1 downstream_gene_variant ; 1043.0bp to feature; MODIFIER silent_mutation Average:75.925; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg0138075905 G -> A LOC_Os01g65580.2 downstream_gene_variant ; 4213.0bp to feature; MODIFIER silent_mutation Average:75.925; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg0138075905 G -> A LOC_Os01g65580.3 downstream_gene_variant ; 4209.0bp to feature; MODIFIER silent_mutation Average:75.925; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg0138075905 G -> A LOC_Os01g65590-LOC_Os01g65600 intergenic_region ; MODIFIER silent_mutation Average:75.925; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138075905 NA 9.44E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138075905 3.04E-06 3.05E-09 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 2.01E-08 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 5.48E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 8.46E-06 8.05E-10 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 6.99E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 4.33E-08 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 7.23E-13 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 6.18E-06 6.18E-06 mr1670 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 3.10E-07 NA mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 4.04E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 2.90E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 4.14E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 9.35E-06 NA mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 2.13E-06 2.14E-17 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 1.02E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 2.06E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 1.51E-07 2.10E-19 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 1.78E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 1.62E-10 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 1.79E-08 NA mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 7.18E-08 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138075905 NA 1.69E-10 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251