\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137832714:

Variant ID: vg0137832714 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37832714
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCTTAAAATAAATAGAGGACTTATTTATCTTAACTTAGATTGTAGCTCAGAACAACACGAGAATGCAATCGGCGACACAGACGAGGCAAACACCAACA[G/A]
CAACAGCAACAGTAGCGGAATCAACGGACTAACACCCAACACCACATGTGACGGCTGGGAACCAGAACGAAACCCTATTTTTCACTTCACTTCATCTTCT

Reverse complement sequence

AGAAGATGAAGTGAAGTGAAAAATAGGGTTTCGTTCTGGTTCCCAGCCGTCACATGTGGTGTTGGGTGTTAGTCCGTTGATTCCGCTACTGTTGCTGTTG[C/T]
TGTTGGTGTTTGCCTCGTCTGTGTCGCCGATTGCATTCTCGTGTTGTTCTGAGCTACAATCTAAGTTAAGATAAATAAGTCCTCTATTTATTTTAAGCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 41.20% 0.25% 0.00% NA
All Indica  2759 33.90% 65.60% 0.43% 0.00% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 71.40% 28.60% 0.00% 0.00% NA
Indica I  595 37.60% 62.20% 0.17% 0.00% NA
Indica II  465 15.70% 83.70% 0.65% 0.00% NA
Indica III  913 42.40% 57.40% 0.22% 0.00% NA
Indica Intermediate  786 32.10% 67.20% 0.76% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137832714 G -> A LOC_Os01g65200.3 upstream_gene_variant ; 1463.0bp to feature; MODIFIER silent_mutation Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0137832714 G -> A LOC_Os01g65210.1 upstream_gene_variant ; 4423.0bp to feature; MODIFIER silent_mutation Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0137832714 G -> A LOC_Os01g65200.1 upstream_gene_variant ; 1463.0bp to feature; MODIFIER silent_mutation Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0137832714 G -> A LOC_Os01g65200.2 upstream_gene_variant ; 1463.0bp to feature; MODIFIER silent_mutation Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0137832714 G -> A LOC_Os01g65190.1 downstream_gene_variant ; 333.0bp to feature; MODIFIER silent_mutation Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0137832714 G -> A LOC_Os01g65190-LOC_Os01g65200 intergenic_region ; MODIFIER silent_mutation Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137832714 NA 1.73E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 1.24E-08 1.14E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 6.27E-06 6.79E-08 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 4.69E-20 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 3.82E-16 8.49E-20 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 2.04E-19 5.52E-77 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 1.25E-12 5.65E-16 mr1538 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 9.38E-24 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 4.83E-17 9.37E-20 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 1.34E-20 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137832714 3.08E-13 1.17E-19 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251