| Variant ID: vg0137832714 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 37832714 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 108. )
ATGCTTAAAATAAATAGAGGACTTATTTATCTTAACTTAGATTGTAGCTCAGAACAACACGAGAATGCAATCGGCGACACAGACGAGGCAAACACCAACA[G/A]
CAACAGCAACAGTAGCGGAATCAACGGACTAACACCCAACACCACATGTGACGGCTGGGAACCAGAACGAAACCCTATTTTTCACTTCACTTCATCTTCT
AGAAGATGAAGTGAAGTGAAAAATAGGGTTTCGTTCTGGTTCCCAGCCGTCACATGTGGTGTTGGGTGTTAGTCCGTTGATTCCGCTACTGTTGCTGTTG[C/T]
TGTTGGTGTTTGCCTCGTCTGTGTCGCCGATTGCATTCTCGTGTTGTTCTGAGCTACAATCTAAGTTAAGATAAATAAGTCCTCTATTTATTTTAAGCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.50% | 41.20% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 33.90% | 65.60% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 37.60% | 62.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 15.70% | 83.70% | 0.65% | 0.00% | NA |
| Indica III | 913 | 42.40% | 57.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 32.10% | 67.20% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0137832714 | G -> A | LOC_Os01g65200.3 | upstream_gene_variant ; 1463.0bp to feature; MODIFIER | silent_mutation | Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0137832714 | G -> A | LOC_Os01g65210.1 | upstream_gene_variant ; 4423.0bp to feature; MODIFIER | silent_mutation | Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0137832714 | G -> A | LOC_Os01g65200.1 | upstream_gene_variant ; 1463.0bp to feature; MODIFIER | silent_mutation | Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0137832714 | G -> A | LOC_Os01g65200.2 | upstream_gene_variant ; 1463.0bp to feature; MODIFIER | silent_mutation | Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0137832714 | G -> A | LOC_Os01g65190.1 | downstream_gene_variant ; 333.0bp to feature; MODIFIER | silent_mutation | Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0137832714 | G -> A | LOC_Os01g65190-LOC_Os01g65200 | intergenic_region ; MODIFIER | silent_mutation | Average:58.246; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0137832714 | NA | 1.73E-13 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 1.24E-08 | 1.14E-25 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 6.27E-06 | 6.79E-08 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 4.69E-20 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 3.82E-16 | 8.49E-20 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 2.04E-19 | 5.52E-77 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 1.25E-12 | 5.65E-16 | mr1538 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 9.38E-24 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 4.83E-17 | 9.37E-20 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 1.34E-20 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0137832714 | 3.08E-13 | 1.17E-19 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |