Variant ID: vg0137487606 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 37487606 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.10, T: 0.01, others allele: 0.00, population size: 73. )
CCAATTAACGAATTTGTTGTATATTTGTCGACAAATTTTCCTCCAAAAATTTATCAAATGTAATTACAGTATAATCGTAGTGTAATTATGTAACTTTCAA[A/G]
AATCTCTCGGTAACATGTTATTTCAGTAAAATAGAGGTCGTGGGAACAAATCCTTTCACATATGTGTGTGCTGTGATTATTTTTCTTCCTCACTAGAACA
TGTTCTAGTGAGGAAGAAAAATAATCACAGCACACACATATGTGAAAGGATTTGTTCCCACGACCTCTATTTTACTGAAATAACATGTTACCGAGAGATT[T/C]
TTGAAAGTTACATAATTACACTACGATTATACTGTAATTACATTTGATAAATTTTTGGAGGAAAATTTGTCGACAAATATACAACAAATTCGTTAATTGG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 58.40% | 41.30% | 0.25% | 0.00% | NA |
All Indica | 2759 | 95.50% | 4.20% | 0.33% | 0.00% | NA |
All Japonica | 1512 | 1.90% | 98.00% | 0.13% | 0.00% | NA |
Aus | 269 | 25.30% | 74.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 97.60% | 2.00% | 0.34% | 0.00% | NA |
Indica II | 465 | 97.80% | 1.90% | 0.22% | 0.00% | NA |
Indica III | 913 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 90.50% | 9.00% | 0.51% | 0.00% | NA |
Temperate Japonica | 767 | 1.40% | 98.30% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
Intermediate | 90 | 32.20% | 66.70% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0137487606 | A -> G | LOC_Os01g64600.1 | upstream_gene_variant ; 3125.0bp to feature; MODIFIER | silent_mutation | Average:80.955; most accessible tissue: Zhenshan97 flower, score: 91.158 | N | N | N | N |
vg0137487606 | A -> G | LOC_Os01g64590-LOC_Os01g64600 | intergenic_region ; MODIFIER | silent_mutation | Average:80.955; most accessible tissue: Zhenshan97 flower, score: 91.158 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0137487606 | NA | 4.91E-24 | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | 2.27E-07 | NA | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | 1.74E-06 | 9.58E-71 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | NA | 3.61E-22 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | 8.16E-07 | NA | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | 3.01E-06 | 3.45E-06 | mr1672 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | NA | 5.22E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | NA | 1.65E-08 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | NA | 8.24E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0137487606 | NA | 8.15E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |