Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135716135:

Variant ID: vg0135716135 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35716135
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAAAGGCAACTCAATAGTATTAGGCCCCTTTAGGGCCCCTTTGATTTGTAGGAAAAATGTAGGAATTTTGGAGGATTTCAATCCTATGGAAAAAAAATC[T/C]
TATGAAGGCCTTTGAGACAAAGGATTGAATCCTATCCAATCCTTTAAAATTCCTATGGAATGGGTAATCCTATGCACATTTTGGAGGAAAGTTAGCAAGA

Reverse complement sequence

TCTTGCTAACTTTCCTCCAAAATGTGCATAGGATTACCCATTCCATAGGAATTTTAAAGGATTGGATAGGATTCAATCCTTTGTCTCAAAGGCCTTCATA[A/G]
GATTTTTTTTCCATAGGATTGAAATCCTCCAAAATTCCTACATTTTTCCTACAAATCAAAGGGGCCCTAAAGGGGCCTAATACTATTGAGTTGCCTTTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.30%	14.20%	3.07%	62.42%	NA
All Indica	2759	1.10%	2.90%	0.76%	95.22%	NA
All Japonica	1512	53.20%	37.60%	7.47%	1.72%	NA
Aus	269	0.70%	4.10%	1.12%	94.05%	NA
Indica I	595	0.00%	4.40%	1.34%	94.29%	NA
Indica II	465	0.20%	4.10%	0.00%	95.70%	NA
Indica III	913	0.70%	0.80%	0.55%	98.03%	NA
Indica Intermediate	786	2.90%	3.70%	1.02%	92.37%	NA
Temperate Japonica	767	31.20%	55.90%	11.73%	1.17%	NA
Tropical Japonica	504	84.70%	10.50%	2.38%	2.38%	NA
Japonica Intermediate	241	57.70%	35.70%	4.56%	2.07%	NA
VI/Aromatic	96	90.60%	0.00%	0.00%	9.38%	NA
Intermediate	90	37.80%	14.40%	8.89%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135716135	T -> DEL	N	N	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.1	upstream_gene_variant ; 2699.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61750.1	upstream_gene_variant ; 4584.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.7	upstream_gene_variant ; 3383.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.4	upstream_gene_variant ; 3040.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.6	upstream_gene_variant ; 2952.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.10	upstream_gene_variant ; 2819.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.9	upstream_gene_variant ; 2819.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.2	upstream_gene_variant ; 2699.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.8	upstream_gene_variant ; 2698.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61720.3	upstream_gene_variant ; 2473.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61730.1	downstream_gene_variant ; 1145.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61760.1	downstream_gene_variant ; 4886.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61760.2	downstream_gene_variant ; 4886.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61760.3	downstream_gene_variant ; 4886.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61760.4	downstream_gene_variant ; 4886.0bp to feature; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0135716135	T -> C	LOC_Os01g61730-LOC_Os01g61750	intergenic_region ; MODIFIER	silent_mutation	Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135716135	2.37E-06	NA	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135716135	NA	9.68E-18	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135716135	1.65E-06	NA	Spikelet_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135716135	NA	1.97E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135716135	NA	5.27E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.36E-15	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	3.24E-12	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	2.60E-13	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	4.80E-15	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	5.63E-06	mr1154	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	9.71E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.36E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.24E-15	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	2.63E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	7.77E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	6.49E-25	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	2.59E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.56E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.59E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	5.92E-13	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.89E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	1.32E-06	NA	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	2.40E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	7.24E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	6.92E-07	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.20E-13	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.38E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.65E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.26E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	5.28E-06	mr1060_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	4.81E-27	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.02E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	7.73E-13	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	5.24E-17	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	7.71E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.22E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	7.56E-06	mr1154_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.36E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.03E-08	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	5.19E-08	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.47E-09	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	4.24E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	6.16E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.04E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.42E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	8.06E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	6.17E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.03E-09	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	4.35E-07	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	8.67E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135	NA	1.78E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251