\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135716135:

Variant ID: vg0135716135 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35716135
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAAGGCAACTCAATAGTATTAGGCCCCTTTAGGGCCCCTTTGATTTGTAGGAAAAATGTAGGAATTTTGGAGGATTTCAATCCTATGGAAAAAAAATC[T/C]
TATGAAGGCCTTTGAGACAAAGGATTGAATCCTATCCAATCCTTTAAAATTCCTATGGAATGGGTAATCCTATGCACATTTTGGAGGAAAGTTAGCAAGA

Reverse complement sequence

TCTTGCTAACTTTCCTCCAAAATGTGCATAGGATTACCCATTCCATAGGAATTTTAAAGGATTGGATAGGATTCAATCCTTTGTCTCAAAGGCCTTCATA[A/G]
GATTTTTTTTCCATAGGATTGAAATCCTCCAAAATTCCTACATTTTTCCTACAAATCAAAGGGGCCCTAAAGGGGCCTAATACTATTGAGTTGCCTTTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.30% 14.20% 3.07% 62.42% NA
All Indica  2759 1.10% 2.90% 0.76% 95.22% NA
All Japonica  1512 53.20% 37.60% 7.47% 1.72% NA
Aus  269 0.70% 4.10% 1.12% 94.05% NA
Indica I  595 0.00% 4.40% 1.34% 94.29% NA
Indica II  465 0.20% 4.10% 0.00% 95.70% NA
Indica III  913 0.70% 0.80% 0.55% 98.03% NA
Indica Intermediate  786 2.90% 3.70% 1.02% 92.37% NA
Temperate Japonica  767 31.20% 55.90% 11.73% 1.17% NA
Tropical Japonica  504 84.70% 10.50% 2.38% 2.38% NA
Japonica Intermediate  241 57.70% 35.70% 4.56% 2.07% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 37.80% 14.40% 8.89% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135716135 T -> DEL N N silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.1 upstream_gene_variant ; 2699.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61750.1 upstream_gene_variant ; 4584.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.7 upstream_gene_variant ; 3383.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.4 upstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.6 upstream_gene_variant ; 2952.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.10 upstream_gene_variant ; 2819.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.9 upstream_gene_variant ; 2819.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.2 upstream_gene_variant ; 2699.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.8 upstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61720.3 upstream_gene_variant ; 2473.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61730.1 downstream_gene_variant ; 1145.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61760.1 downstream_gene_variant ; 4886.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61760.2 downstream_gene_variant ; 4886.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61760.3 downstream_gene_variant ; 4886.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61760.4 downstream_gene_variant ; 4886.0bp to feature; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0135716135 T -> C LOC_Os01g61730-LOC_Os01g61750 intergenic_region ; MODIFIER silent_mutation Average:56.535; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135716135 2.37E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135716135 NA 9.68E-18 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135716135 1.65E-06 NA Spikelet_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135716135 NA 1.97E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135716135 NA 5.27E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.36E-15 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 3.24E-12 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 2.60E-13 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 4.80E-15 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 5.63E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 9.71E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.36E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.24E-15 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 2.63E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 7.77E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 6.49E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 2.59E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.56E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.59E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 5.92E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.89E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 1.32E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 2.40E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 7.24E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 6.92E-07 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.20E-13 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.38E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.65E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.26E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 5.28E-06 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 4.81E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.02E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 7.73E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 5.24E-17 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 7.71E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.22E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 7.56E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.36E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.03E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 5.19E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.47E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 4.24E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 6.16E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.04E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.42E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 8.06E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 6.17E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.03E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 4.35E-07 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 8.67E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135716135 NA 1.78E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251