\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135077792:

Variant ID: vg0135077792 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35077792
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCCACGACGCTCACAGGGCTCTATTTGGAAGATTAGTCCAGAGCTAATTTTGACAGCTAATATTTAGTCATAAATTGTTAGGCTAAACATTAGCCTAT[G/A]
GTGGTATATTTGGATCTATGGGCTAATTCAAGGCTAAAAGGTGGGGAGAGAGTAGAAAGAGAGGAGAGAGAAGGAGAGAAAAAGCTGCTTTTTGATAGTC

Reverse complement sequence

GACTATCAAAAAGCAGCTTTTTCTCTCCTTCTCTCTCCTCTCTTTCTACTCTCTCCCCACCTTTTAGCCTTGAATTAGCCCATAGATCCAAATATACCAC[C/T]
ATAGGCTAATGTTTAGCCTAACAATTTATGACTAAATATTAGCTGTCAAAATTAGCTCTGGACTAATCTTCCAAATAGAGCCCTGTGAGCGTCGTGGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 23.00% 2.56% 0.00% NA
All Indica  2759 72.10% 23.70% 4.28% 0.00% NA
All Japonica  1512 89.90% 10.00% 0.13% 0.00% NA
Aus  269 4.50% 95.50% 0.00% 0.00% NA
Indica I  595 72.60% 16.30% 11.09% 0.00% NA
Indica II  465 27.50% 66.50% 6.02% 0.00% NA
Indica III  913 97.50% 2.40% 0.11% 0.00% NA
Indica Intermediate  786 68.40% 28.60% 2.93% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 76.80% 23.20% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 9.50% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135077792 G -> A LOC_Os01g60660.1 upstream_gene_variant ; 3301.0bp to feature; MODIFIER silent_mutation Average:89.599; most accessible tissue: Callus, score: 98.391 N N N N
vg0135077792 G -> A LOC_Os01g60660.2 upstream_gene_variant ; 3301.0bp to feature; MODIFIER silent_mutation Average:89.599; most accessible tissue: Callus, score: 98.391 N N N N
vg0135077792 G -> A LOC_Os01g60670.1 downstream_gene_variant ; 4133.0bp to feature; MODIFIER silent_mutation Average:89.599; most accessible tissue: Callus, score: 98.391 N N N N
vg0135077792 G -> A LOC_Os01g60660-LOC_Os01g60670 intergenic_region ; MODIFIER silent_mutation Average:89.599; most accessible tissue: Callus, score: 98.391 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0135077792 G A 0.0 0.02 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135077792 NA 7.42E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135077792 NA 4.89E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 7.41E-07 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 7.56E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 1.16E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 6.31E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 5.02E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 2.99E-08 mr1676 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 2.21E-11 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 1.18E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 1.06E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 3.77E-07 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 1.18E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 4.06E-13 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 2.19E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 9.73E-08 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 8.53E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 6.82E-06 mr1438_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 5.53E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 5.47E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 2.08E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135077792 NA 2.49E-07 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251