\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134951253:

Variant ID: vg0134951253 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34951253
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGAGTATTAGAGAGGTTACCAAGCCATTTATTATATAAGGCTGGCCATATGCACATCCTATACGAGGCAGCCAAATGTATTAGTGATAGGATGAGAAA[C/T]
TTCACTATAATTGTCCCAGTATTCAAATAGTAATTAGAAAAACGACTGGATCAAATCAAGACAATCAACTTAAAGAAATATTTATTTCTATTGACATGTA

Reverse complement sequence

TACATGTCAATAGAAATAAATATTTCTTTAAGTTGATTGTCTTGATTTGATCCAGTCGTTTTTCTAATTACTATTTGAATACTGGGACAATTATAGTGAA[G/A]
TTTCTCATCCTATCACTAATACATTTGGCTGCCTCGTATAGGATGTGCATATGGCCAGCCTTATATAATAAATGGCTTGGTAACCTCTCTAATACTCCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.20% 0.00% 0.23% NA
All Indica  2759 82.80% 16.80% 0.00% 0.40% NA
All Japonica  1512 1.90% 98.10% 0.00% 0.00% NA
Aus  269 34.60% 65.40% 0.00% 0.00% NA
Indica I  595 89.60% 10.40% 0.00% 0.00% NA
Indica II  465 96.10% 3.70% 0.00% 0.22% NA
Indica III  913 80.40% 19.10% 0.00% 0.55% NA
Indica Intermediate  786 72.50% 26.80% 0.00% 0.64% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134951253 C -> T LOC_Os01g60430.1 downstream_gene_variant ; 2226.0bp to feature; MODIFIER silent_mutation Average:56.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0134951253 C -> T LOC_Os01g60440.1 intron_variant ; MODIFIER silent_mutation Average:56.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0134951253 C -> DEL N N silent_mutation Average:56.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134951253 NA 9.89E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 NA 5.01E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 9.67E-07 7.29E-08 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 1.05E-06 7.42E-07 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 NA 1.69E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 NA 4.08E-08 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 2.12E-07 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 1.08E-09 1.37E-10 mr1008_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 NA 3.16E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 NA 5.97E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134951253 NA 1.64E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251