\
| Variant ID: vg0134951253 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 34951253 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 200. )
AGGGAGTATTAGAGAGGTTACCAAGCCATTTATTATATAAGGCTGGCCATATGCACATCCTATACGAGGCAGCCAAATGTATTAGTGATAGGATGAGAAA[C/T]
TTCACTATAATTGTCCCAGTATTCAAATAGTAATTAGAAAAACGACTGGATCAAATCAAGACAATCAACTTAAAGAAATATTTATTTCTATTGACATGTA
TACATGTCAATAGAAATAAATATTTCTTTAAGTTGATTGTCTTGATTTGATCCAGTCGTTTTTCTAATTACTATTTGAATACTGGGACAATTATAGTGAA[G/A]
TTTCTCATCCTATCACTAATACATTTGGCTGCCTCGTATAGGATGTGCATATGGCCAGCCTTATATAATAAATGGCTTGGTAACCTCTCTAATACTCCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.60% | 48.20% | 0.00% | 0.23% | NA |
| All Indica | 2759 | 82.80% | 16.80% | 0.00% | 0.40% | NA |
| All Japonica | 1512 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.60% | 65.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.00% | 0.22% | NA |
| Indica III | 913 | 80.40% | 19.10% | 0.00% | 0.55% | NA |
| Indica Intermediate | 786 | 72.50% | 26.80% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 66.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0134951253 | C -> T | LOC_Os01g60430.1 | downstream_gene_variant ; 2226.0bp to feature; MODIFIER | silent_mutation | Average:56.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0134951253 | C -> T | LOC_Os01g60440.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0134951253 | C -> DEL | N | N | silent_mutation | Average:56.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0134951253 | NA | 9.89E-22 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | NA | 5.01E-06 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | 9.67E-07 | 7.29E-08 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | 1.05E-06 | 7.42E-07 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | NA | 1.69E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | NA | 4.08E-08 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | 2.12E-07 | NA | mr1008_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | 1.08E-09 | 1.37E-10 | mr1008_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | NA | 3.16E-09 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | NA | 5.97E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134951253 | NA | 1.64E-12 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |