Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134351900:

Variant ID: vg0134351900 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34351900
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.07, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCCAGCTGTGGTCTTTAGCCGGCGTTGCTTTTTTTGGGATTTCTTGGAAGTGTAGCATAGCTCTGCCCTCTCCCGCTGTTTGGAGTTGCGTTTTTAAC[C/A]
GTCGTAGTAGTTCCTAACTTCAAGTCCCCCCCTTTAGGCATAAGCCAGTCTGGCTGATTACTTTGTGTAACAAAAACTCTTTTCCTGCTAATATATTGAC

Reverse complement sequence

GTCAATATATTAGCAGGAAAAGAGTTTTTGTTACACAAAGTAATCAGCCAGACTGGCTTATGCCTAAAGGGGGGGACTTGAAGTTAGGAACTACTACGAC[G/T]
GTTAAAAACGCAACTCCAAACAGCGGGAGAGGGCAGAGCTATGCTACACTTCCAAGAAATCCCAAAAAAAGCAACGCCGGCTAAAGACCACAGCTGGCCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	36.00%	0.06%	0.00%	NA
All Indica	2759	97.30%	2.60%	0.04%	0.00%	NA
All Japonica	1512	1.90%	98.00%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	96.00%	4.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	2.60%	97.40%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.10%	0.41%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	35.60%	63.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134351900	C -> A	LOC_Os01g59400.1	upstream_gene_variant ; 41.0bp to feature; MODIFIER	silent_mutation	Average:53.302; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0134351900	C -> A	LOC_Os01g59410.1	upstream_gene_variant ; 4740.0bp to feature; MODIFIER	silent_mutation	Average:53.302; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0134351900	C -> A	LOC_Os01g59400-LOC_Os01g59410	intergenic_region ; MODIFIER	silent_mutation	Average:53.302; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134351900	NA	1.14E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	3.79E-12	1.46E-128	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	5.08E-08	6.69E-11	mr1008	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	4.11E-11	6.66E-125	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	5.36E-07	1.06E-09	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	6.46E-07	1.45E-81	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	2.59E-07	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	1.66E-06	4.41E-82	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	4.54E-56	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	1.11E-14	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	8.75E-23	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	1.58E-86	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	1.22E-09	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	1.64E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	9.43E-69	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	8.18E-07	1.24E-121	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	9.06E-08	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900	NA	1.45E-86	mr1015_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251