\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134351900:

Variant ID: vg0134351900 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34351900
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.07, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCCAGCTGTGGTCTTTAGCCGGCGTTGCTTTTTTTGGGATTTCTTGGAAGTGTAGCATAGCTCTGCCCTCTCCCGCTGTTTGGAGTTGCGTTTTTAAC[C/A]
GTCGTAGTAGTTCCTAACTTCAAGTCCCCCCCTTTAGGCATAAGCCAGTCTGGCTGATTACTTTGTGTAACAAAAACTCTTTTCCTGCTAATATATTGAC

Reverse complement sequence

GTCAATATATTAGCAGGAAAAGAGTTTTTGTTACACAAAGTAATCAGCCAGACTGGCTTATGCCTAAAGGGGGGGACTTGAAGTTAGGAACTACTACGAC[G/T]
GTTAAAAACGCAACTCCAAACAGCGGGAGAGGGCAGAGCTATGCTACACTTCCAAGAAATCCCAAAAAAAGCAACGCCGGCTAAAGACCACAGCTGGCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 36.00% 0.06% 0.00% NA
All Indica  2759 97.30% 2.60% 0.04% 0.00% NA
All Japonica  1512 1.90% 98.00% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 35.60% 63.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134351900 C -> A LOC_Os01g59400.1 upstream_gene_variant ; 41.0bp to feature; MODIFIER silent_mutation Average:53.302; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0134351900 C -> A LOC_Os01g59410.1 upstream_gene_variant ; 4740.0bp to feature; MODIFIER silent_mutation Average:53.302; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0134351900 C -> A LOC_Os01g59400-LOC_Os01g59410 intergenic_region ; MODIFIER silent_mutation Average:53.302; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134351900 NA 1.14E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 3.79E-12 1.46E-128 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 5.08E-08 6.69E-11 mr1008 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 4.11E-11 6.66E-125 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 5.36E-07 1.06E-09 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 6.46E-07 1.45E-81 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 2.59E-07 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 1.66E-06 4.41E-82 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 4.54E-56 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 1.11E-14 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 8.75E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 1.58E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 1.22E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 1.64E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 9.43E-69 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 8.18E-07 1.24E-121 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 9.06E-08 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134351900 NA 1.45E-86 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251