\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134230502:

Variant ID: vg0134230502 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34230502
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, C: 0.05, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTGAATAATCTCACATTGCTTAGCTTGGGAGGAGGAAGCCACCTTAAAAGAGAGAGCCACCCTTCCCCTATTAGACTAGTATTTTAGAAAGATTGGTC[A/C,T]
TTTCCCTGAGTGGGTGTGCCTAAGAACTGTTGGGATCTGGACAACCTTTAAGTTATCAATACATATACCCCACTCCAAACAATCAACATTGATAGAGCAC

Reverse complement sequence

GTGCTCTATCAATGTTGATTGTTTGGAGTGGGGTATATGTATTGATAACTTAAAGGTTGTCCAGATCCCAACAGTTCTTAGGCACACCCACTCAGGGAAA[T/G,A]
GACCAATCTTTCTAAAATACTAGTCTAATAGGGGAAGGGTGGCTCTCTCTTTTAAGGTGGCTTCCTCCTCCCAAGCTAAGCAATGTGAGATTATTCAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 44.70% 0.02% 0.21% T: 0.28%
All Indica  2759 56.30% 42.80% 0.04% 0.36% T: 0.47%
All Japonica  1512 64.90% 35.10% 0.00% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 25.40% 73.80% 0.17% 0.67% NA
Indica II  465 94.80% 4.50% 0.00% 0.43% T: 0.22%
Indica III  913 49.30% 49.60% 0.00% 0.00% T: 1.10%
Indica Intermediate  786 65.10% 34.10% 0.00% 0.51% T: 0.25%
Temperate Japonica  767 92.70% 7.30% 0.00% 0.00% NA
Tropical Japonica  504 34.10% 65.90% 0.00% 0.00% NA
Japonica Intermediate  241 40.70% 59.30% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134230502 A -> T LOC_Os01g59230.1 downstream_gene_variant ; 1524.0bp to feature; MODIFIER silent_mutation Average:68.247; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0134230502 A -> T LOC_Os01g59220-LOC_Os01g59230 intergenic_region ; MODIFIER silent_mutation Average:68.247; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0134230502 A -> DEL N N silent_mutation Average:68.247; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0134230502 A -> C LOC_Os01g59230.1 downstream_gene_variant ; 1524.0bp to feature; MODIFIER silent_mutation Average:68.247; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0134230502 A -> C LOC_Os01g59220-LOC_Os01g59230 intergenic_region ; MODIFIER silent_mutation Average:68.247; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134230502 NA 7.66E-26 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0134230502 NA 1.75E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 3.57E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 1.69E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 2.84E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 2.51E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 9.44E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 8.57E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 5.71E-10 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 4.89E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 5.49E-15 mr1942 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 7.31E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 3.92E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 5.22E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 9.24E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 1.18E-10 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 3.15E-08 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 6.64E-08 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 1.36E-06 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 9.15E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 7.99E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 2.14E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 8.37E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 4.14E-10 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 5.41E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 1.04E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 9.36E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 6.19E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 1.10E-10 mr1528_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 3.64E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 1.67E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 6.16E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 3.34E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 1.41E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 4.77E-25 mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 3.76E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 1.05E-09 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134230502 NA 5.32E-09 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251