\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134197545:

Variant ID: vg0134197545 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34197545
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAATTTGGAATTAAAAATAAGAAATATAAGAAGTAGAGTATAGAATCCATATAGAAATACAATTAGGAAATAAATAAAAATTCGGAATTAAAAATAAC[G/T]
AATATTAGAAGTAGAGTATAGAGTCCATAAAGAAATACAATTAAGAAAGAAAAATAGAAATTCAGAATTAAAAAATAAGGAATATTAGAAGTAGAGTATA

Reverse complement sequence

TATACTCTACTTCTAATATTCCTTATTTTTTAATTCTGAATTTCTATTTTTCTTTCTTAATTGTATTTCTTTATGGACTCTATACTCTACTTCTAATATT[C/A]
GTTATTTTTAATTCCGAATTTTTATTTATTTCCTAATTGTATTTCTATATGGATTCTATACTCTACTTCTTATATTTCTTATTTTTAATTCCAAATTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 3.30% 1.29% 2.67% NA
All Indica  2759 97.50% 0.10% 0.94% 1.52% NA
All Japonica  1512 82.90% 9.60% 2.12% 5.42% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.17% 0.34% NA
Indica II  465 92.70% 0.20% 3.01% 4.09% NA
Indica III  913 98.80% 0.10% 0.22% 0.88% NA
Indica Intermediate  786 97.20% 0.00% 1.15% 1.65% NA
Temperate Japonica  767 94.50% 0.00% 0.52% 4.95% NA
Tropical Japonica  504 66.30% 28.00% 2.98% 2.78% NA
Japonica Intermediate  241 80.50% 1.70% 5.39% 12.45% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 87.80% 7.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134197545 G -> T LOC_Os01g59200.1 upstream_gene_variant ; 3974.0bp to feature; MODIFIER silent_mutation Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0134197545 G -> T LOC_Os01g59190.1 downstream_gene_variant ; 3376.0bp to feature; MODIFIER silent_mutation Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0134197545 G -> T LOC_Os01g59190-LOC_Os01g59200 intergenic_region ; MODIFIER silent_mutation Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0134197545 G -> DEL N N silent_mutation Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134197545 4.27E-07 NA mr1925 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134197545 NA 2.24E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134197545 NA 2.09E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251