\
| Variant ID: vg0134197545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 34197545 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGAAATTTGGAATTAAAAATAAGAAATATAAGAAGTAGAGTATAGAATCCATATAGAAATACAATTAGGAAATAAATAAAAATTCGGAATTAAAAATAAC[G/T]
AATATTAGAAGTAGAGTATAGAGTCCATAAAGAAATACAATTAAGAAAGAAAAATAGAAATTCAGAATTAAAAAATAAGGAATATTAGAAGTAGAGTATA
TATACTCTACTTCTAATATTCCTTATTTTTTAATTCTGAATTTCTATTTTTCTTTCTTAATTGTATTTCTTTATGGACTCTATACTCTACTTCTAATATT[C/A]
GTTATTTTTAATTCCGAATTTTTATTTATTTCCTAATTGTATTTCTATATGGATTCTATACTCTACTTCTTATATTTCTTATTTTTAATTCCAAATTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 3.30% | 1.29% | 2.67% | NA |
| All Indica | 2759 | 97.50% | 0.10% | 0.94% | 1.52% | NA |
| All Japonica | 1512 | 82.90% | 9.60% | 2.12% | 5.42% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.17% | 0.34% | NA |
| Indica II | 465 | 92.70% | 0.20% | 3.01% | 4.09% | NA |
| Indica III | 913 | 98.80% | 0.10% | 0.22% | 0.88% | NA |
| Indica Intermediate | 786 | 97.20% | 0.00% | 1.15% | 1.65% | NA |
| Temperate Japonica | 767 | 94.50% | 0.00% | 0.52% | 4.95% | NA |
| Tropical Japonica | 504 | 66.30% | 28.00% | 2.98% | 2.78% | NA |
| Japonica Intermediate | 241 | 80.50% | 1.70% | 5.39% | 12.45% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0134197545 | G -> T | LOC_Os01g59200.1 | upstream_gene_variant ; 3974.0bp to feature; MODIFIER | silent_mutation | Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0134197545 | G -> T | LOC_Os01g59190.1 | downstream_gene_variant ; 3376.0bp to feature; MODIFIER | silent_mutation | Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0134197545 | G -> T | LOC_Os01g59190-LOC_Os01g59200 | intergenic_region ; MODIFIER | silent_mutation | Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0134197545 | G -> DEL | N | N | silent_mutation | Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0134197545 | 4.27E-07 | NA | mr1925 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134197545 | NA | 2.24E-06 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134197545 | NA | 2.09E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |