Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0134084206:

Variant ID: vg0134084206 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34084206
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGTTTCGAGCCTAATCAACTTTTATTATAGTTCGTGTGTGCGCCTGGATCAATTATTTGTGAACTAGAGAGAGCTGTACCAAAGCTGAACCTAAGAA[C/T]
CTGATTATTTGAGCGGGCGTCCACTGTCTAGCTTTACTAGTACTACTATTGATCGAGTCAATGATCGCTCTACTAGTACTACTATTGATCGAGTCAATGA

Reverse complement sequence

TCATTGACTCGATCAATAGTAGTACTAGTAGAGCGATCATTGACTCGATCAATAGTAGTACTAGTAAAGCTAGACAGTGGACGCCCGCTCAAATAATCAG[G/A]
TTCTTAGGTTCAGCTTTGGTACAGCTCTCTCTAGTTCACAAATAATTGATCCAGGCGCACACACGAACTATAATAAAAGTTGATTAGGCTCGAAACAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	1.90%	3.60%	1.69%	NA
All Indica	2759	98.10%	1.10%	0.40%	0.43%	NA
All Japonica	1512	81.70%	3.80%	10.25%	4.23%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.60%	2.00%	0.50%	0.84%	NA
Indica II	465	98.90%	0.60%	0.22%	0.22%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	1.80%	0.89%	0.76%	NA
Temperate Japonica	767	67.50%	6.40%	18.12%	7.95%	NA
Tropical Japonica	504	97.80%	0.60%	0.99%	0.60%	NA
Japonica Intermediate	241	92.90%	2.50%	4.56%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	87.80%	4.40%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134084206	C -> T	LOC_Os01g58960.1	upstream_gene_variant ; 551.0bp to feature; MODIFIER	silent_mutation	Average:69.401; most accessible tissue: Callus, score: 95.745	N	N	N	N
vg0134084206	C -> T	LOC_Os01g58950-LOC_Os01g58960	intergenic_region ; MODIFIER	silent_mutation	Average:69.401; most accessible tissue: Callus, score: 95.745	N	N	N	N
vg0134084206	C -> DEL	N	N	silent_mutation	Average:69.401; most accessible tissue: Callus, score: 95.745	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0134084206	C	T	0.02	0.02	0.02	0.0	0.02	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134084206	NA	3.62E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	3.49E-07	1.82E-12	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	2.23E-06	1.13E-08	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	1.70E-06	7.16E-11	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	2.15E-06	4.53E-08	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	1.07E-07	1.73E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	4.30E-07	6.89E-09	mr1650	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	4.71E-06	7.10E-10	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	4.90E-06	1.64E-07	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	NA	8.96E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	NA	6.58E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	NA	1.49E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134084206	NA	7.12E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251