Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0133978114:

Variant ID: vg0133978114 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33978114
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGCAAGTTGCTTCTTGTGTGTTTTTTGTGGGTCCCACTAGTACCAGCTTTACTATTTTTTTCTCTCTGCTCTCTCTCATGTCCAATTTTCCCCACCGC[A/G]
CAGAGAGTGCCGAGCGCATCGGGCGGAGCAGCCAAGCGCAACGGCGCCGACCGGAGGGGCGACGGACCTGGTGCTCGCCGGCACACCACCCTCATCTCCC

Reverse complement sequence

GGGAGATGAGGGTGGTGTGCCGGCGAGCACCAGGTCCGTCGCCCCTCCGGTCGGCGCCGTTGCGCTTGGCTGCTCCGCCCGATGCGCTCGGCACTCTCTG[T/C]
GCGGTGGGGAAAATTGGACATGAGAGAGAGCAGAGAGAAAAAAATAGTAAAGCTGGTACTAGTGGGACCCACAAAAAACACACAAGAAGCAACTTGCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.10% 0.06% 0.00% NA
All Indica  2759 97.50% 2.50% 0.07% 0.00% NA
All Japonica  1512 13.80% 86.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 99.10% 0.80% 0.11% 0.00% NA
Indica Intermediate  786 95.50% 4.50% 0.00% 0.00% NA
Temperate Japonica  767 9.60% 90.40% 0.00% 0.00% NA
Tropical Japonica  504 13.10% 86.90% 0.00% 0.00% NA
Japonica Intermediate  241 28.60% 71.40% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 35.60% 63.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133978114 A -> G LOC_Os01g58800.1 upstream_gene_variant ; 788.0bp to feature; MODIFIER silent_mutation Average:94.484; most accessible tissue: Zhenshan97 flower, score: 99.675 N N N N
vg0133978114 A -> G LOC_Os01g58810.1 upstream_gene_variant ; 2034.0bp to feature; MODIFIER silent_mutation Average:94.484; most accessible tissue: Zhenshan97 flower, score: 99.675 N N N N
vg0133978114 A -> G LOC_Os01g58790.1 downstream_gene_variant ; 1644.0bp to feature; MODIFIER silent_mutation Average:94.484; most accessible tissue: Zhenshan97 flower, score: 99.675 N N N N
vg0133978114 A -> G LOC_Os01g58790.2 downstream_gene_variant ; 788.0bp to feature; MODIFIER silent_mutation Average:94.484; most accessible tissue: Zhenshan97 flower, score: 99.675 N N N N
vg0133978114 A -> G LOC_Os01g58790-LOC_Os01g58810 intergenic_region ; MODIFIER silent_mutation Average:94.484; most accessible tissue: Zhenshan97 flower, score: 99.675 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0133978114 A G -0.02 -0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133978114 2.09E-08 8.23E-109 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 2.69E-08 3.53E-107 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 3.32E-71 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 1.25E-17 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 4.52E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 8.04E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 4.95E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 1.10E-16 mr1239 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 8.90E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 1.67E-20 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 2.72E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 8.57E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 7.10E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 7.29E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 4.44E-26 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 5.99E-07 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 2.75E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 6.40E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133978114 NA 3.29E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251