Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133799491:

Variant ID: vg0133799491 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33799491
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGTCGCTCAACTTGTCATCGAGTTACAAAATCGTCCCCTAACCGTAAAATTGGATACAACGCATCCCTGGTAACAACCAAATTTGGTAATATCAGCAT[T/C]
GGAAAAGAGAATTAGATCGAAGTGGAGTCGAAGGCGGAGATCGATTCGAGAACAGAGCAAGAATCGGCTGGAGTTCGGATCAGCTACGATTGGATTGGCT

Reverse complement sequence

AGCCAATCCAATCGTAGCTGATCCGAACTCCAGCCGATTCTTGCTCTGTTCTCGAATCGATCTCCGCCTTCGACTCCACTTCGATCTAATTCTCTTTTCC[A/G]
ATGCTGATATTACCAAATTTGGTTGTTACCAGGGATGCGTTGTATCCAATTTTACGGTTAGGGGACGATTTTGTAACTCGATGACAAGTTGAGCGACCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.10%	0.19%	0.02%	NA
All Indica	2759	97.10%	2.80%	0.04%	0.04%	NA
All Japonica	1512	6.40%	93.50%	0.07%	0.00%	NA
Aus	269	89.60%	7.80%	2.60%	0.00%	NA
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	98.70%	1.20%	0.00%	0.11%	NA
Indica Intermediate	786	95.00%	4.80%	0.13%	0.00%	NA
Temperate Japonica	767	8.20%	91.70%	0.13%	0.00%	NA
Tropical Japonica	504	2.20%	97.80%	0.00%	0.00%	NA
Japonica Intermediate	241	9.50%	90.50%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	37.80%	62.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133799491	T -> DEL	N	N	silent_mutation	Average:44.714; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0133799491	T -> C	LOC_Os01g58470.1	upstream_gene_variant ; 3663.0bp to feature; MODIFIER	silent_mutation	Average:44.714; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0133799491	T -> C	LOC_Os01g58459-LOC_Os01g58470	intergenic_region ; MODIFIER	silent_mutation	Average:44.714; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133799491	NA	1.10E-08	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	1.53E-09	3.03E-112	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	1.43E-07	2.59E-10	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	7.10E-09	5.60E-109	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	2.76E-07	9.84E-10	mr1009	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	NA	2.57E-69	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	NA	8.00E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	2.32E-11	2.99E-114	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	NA	5.98E-08	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	NA	3.94E-06	mr1008_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133799491	NA	5.61E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251