\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133673919:

Variant ID: vg0133673919 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 33673919
Reference Allele: TAlternative Allele: A,TA,TAA,TAAAA,TAAA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATCCAGTGCTCACCAGGAATCAAAATCGGCATCGATCCATCTGTTCATAGTTAGACTATCACATGTACGGCAATGAAGGGGGCTACATTTTTTTTTTT[T/A,TA,TAA,TAAAA,TAAA]
AAAAAAAAAAGAAGGCAAGAAGATTGCCTTACTTGGAAGGATAGCCGCACCATACAGTGAGGATCTCAAATGCTGTACAGATTACGGCTCATAATTTCTA

Reverse complement sequence

TAGAAATTATGAGCCGTAATCTGTACAGCATTTGAGATCCTCACTGTATGGTGCGGCTATCCTTCCAAGTAAGGCAATCTTCTTGCCTTCTTTTTTTTTT[A/T,TA,TTA,TTTTA,TTTA]
AAAAAAAAAAATGTAGCCCCCTTCATTGCCGTACATGTGATAGTCTAACTATGAACAGATGGATCGATGCCGATTTTGATTCCTGGTGAGCACTGGATCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 36.50% 4.76% 0.99% TA: 2.43%; TAAAA: 1.04%; TAA: 0.91%; TAAA: 0.08%
All Indica  2759 39.10% 52.70% 3.77% 1.70% TAAAA: 1.78%; TA: 0.62%; TAA: 0.18%; TAAA: 0.14%
All Japonica  1512 85.90% 6.10% 5.62% 0.00% TAA: 2.38%
Aus  269 15.60% 42.00% 5.95% 0.00% TA: 36.06%; TAA: 0.37%
Indica I  595 23.70% 61.70% 9.75% 0.00% TAAAA: 4.37%; TAAA: 0.34%; TA: 0.17%
Indica II  465 93.10% 4.50% 0.65% 0.22% TAAAA: 1.29%; TA: 0.22%
Indica III  913 15.40% 78.00% 1.31% 4.49% TAA: 0.44%; TAAAA: 0.33%
Indica Intermediate  786 46.20% 45.20% 3.94% 0.64% TA: 1.91%; TAAAA: 1.78%; TAAA: 0.25%; TAA: 0.13%
Temperate Japonica  767 85.10% 5.00% 7.56% 0.00% TAA: 2.35%
Tropical Japonica  504 85.50% 9.90% 4.37% 0.00% TAA: 0.20%
Japonica Intermediate  241 89.20% 1.70% 2.07% 0.00% TAA: 7.05%
VI/Aromatic  96 40.60% 47.90% 11.46% 0.00% NA
Intermediate  90 68.90% 18.90% 10.00% 0.00% TA: 1.11%; TAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133673919 T -> TAAA LOC_Os01g58270.1 upstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TAAA LOC_Os01g58240.1 downstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TAAA LOC_Os01g58240-LOC_Os01g58270 intergenic_region ; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> A LOC_Os01g58270.1 upstream_gene_variant ; 486.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> A LOC_Os01g58240.1 downstream_gene_variant ; 1381.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> A LOC_Os01g58240-LOC_Os01g58270 intergenic_region ; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TAA LOC_Os01g58270.1 upstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TAA LOC_Os01g58240.1 downstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TAA LOC_Os01g58240-LOC_Os01g58270 intergenic_region ; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TA LOC_Os01g58270.1 upstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TA LOC_Os01g58240.1 downstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TA LOC_Os01g58240-LOC_Os01g58270 intergenic_region ; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TAAAA LOC_Os01g58270.1 upstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TAAAA LOC_Os01g58240.1 downstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> TAAAA LOC_Os01g58240-LOC_Os01g58270 intergenic_region ; MODIFIER silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0133673919 T -> DEL N N silent_mutation Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133673919 NA 4.44E-22 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0133673919 NA 2.63E-07 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.59E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 3.10E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 7.21E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 6.67E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 7.78E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 1.07E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 8.86E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.25E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 8.93E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.98E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.20E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.81E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.30E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 6.00E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.02E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 9.47E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 1.12E-14 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 1.24E-08 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 9.16E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.56E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 1.78E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 1.04E-08 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.90E-07 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 9.72E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.94E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 4.90E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.48E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 6.47E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 8.33E-07 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 4.36E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 8.80E-07 2.14E-11 mr1268_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 1.96E-11 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 4.43E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.01E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 3.26E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 2.09E-12 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 3.93E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 1.72E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 3.34E-13 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 7.08E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 9.72E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 8.96E-11 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 1.28E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 3.44E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 3.42E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 4.05E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919 NA 4.42E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251