Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133673919:

Variant ID: vg0133673919 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 33673919
Reference Allele: T	Alternative Allele: A,TA,TAA,TAAAA,TAAA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATCCAGTGCTCACCAGGAATCAAAATCGGCATCGATCCATCTGTTCATAGTTAGACTATCACATGTACGGCAATGAAGGGGGCTACATTTTTTTTTTT[T/A,TA,TAA,TAAAA,TAAA]
AAAAAAAAAAGAAGGCAAGAAGATTGCCTTACTTGGAAGGATAGCCGCACCATACAGTGAGGATCTCAAATGCTGTACAGATTACGGCTCATAATTTCTA

Reverse complement sequence

TAGAAATTATGAGCCGTAATCTGTACAGCATTTGAGATCCTCACTGTATGGTGCGGCTATCCTTCCAAGTAAGGCAATCTTCTTGCCTTCTTTTTTTTTT[A/T,TA,TTA,TTTTA,TTTA]
AAAAAAAAAAATGTAGCCCCCTTCATTGCCGTACATGTGATAGTCTAACTATGAACAGATGGATCGATGCCGATTTTGATTCCTGGTGAGCACTGGATCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	36.50%	4.76%	0.99%	TA: 2.43%; TAAAA: 1.04%; TAA: 0.91%; TAAA: 0.08%
All Indica	2759	39.10%	52.70%	3.77%	1.70%	TAAAA: 1.78%; TA: 0.62%; TAA: 0.18%; TAAA: 0.14%
All Japonica	1512	85.90%	6.10%	5.62%	0.00%	TAA: 2.38%
Aus	269	15.60%	42.00%	5.95%	0.00%	TA: 36.06%; TAA: 0.37%
Indica I	595	23.70%	61.70%	9.75%	0.00%	TAAAA: 4.37%; TAAA: 0.34%; TA: 0.17%
Indica II	465	93.10%	4.50%	0.65%	0.22%	TAAAA: 1.29%; TA: 0.22%
Indica III	913	15.40%	78.00%	1.31%	4.49%	TAA: 0.44%; TAAAA: 0.33%
Indica Intermediate	786	46.20%	45.20%	3.94%	0.64%	TA: 1.91%; TAAAA: 1.78%; TAAA: 0.25%; TAA: 0.13%
Temperate Japonica	767	85.10%	5.00%	7.56%	0.00%	TAA: 2.35%
Tropical Japonica	504	85.50%	9.90%	4.37%	0.00%	TAA: 0.20%
Japonica Intermediate	241	89.20%	1.70%	2.07%	0.00%	TAA: 7.05%
VI/Aromatic	96	40.60%	47.90%	11.46%	0.00%	NA
Intermediate	90	68.90%	18.90%	10.00%	0.00%	TA: 1.11%; TAA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133673919	T -> TAAA	LOC_Os01g58270.1	upstream_gene_variant ; 485.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TAAA	LOC_Os01g58240.1	downstream_gene_variant ; 1382.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TAAA	LOC_Os01g58240-LOC_Os01g58270	intergenic_region ; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> A	LOC_Os01g58270.1	upstream_gene_variant ; 486.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> A	LOC_Os01g58240.1	downstream_gene_variant ; 1381.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> A	LOC_Os01g58240-LOC_Os01g58270	intergenic_region ; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TAA	LOC_Os01g58270.1	upstream_gene_variant ; 485.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TAA	LOC_Os01g58240.1	downstream_gene_variant ; 1382.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TAA	LOC_Os01g58240-LOC_Os01g58270	intergenic_region ; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TA	LOC_Os01g58270.1	upstream_gene_variant ; 485.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TA	LOC_Os01g58240.1	downstream_gene_variant ; 1382.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TA	LOC_Os01g58240-LOC_Os01g58270	intergenic_region ; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TAAAA	LOC_Os01g58270.1	upstream_gene_variant ; 485.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TAAAA	LOC_Os01g58240.1	downstream_gene_variant ; 1382.0bp to feature; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> TAAAA	LOC_Os01g58240-LOC_Os01g58270	intergenic_region ; MODIFIER	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg0133673919	T -> DEL	N	N	silent_mutation	Average:68.915; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133673919	NA	4.44E-22	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0133673919	NA	2.63E-07	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.59E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	3.10E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	7.21E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	6.67E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	7.78E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	1.07E-16	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	8.86E-10	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.25E-06	mr1185	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	8.93E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.98E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.20E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.81E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.30E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	6.00E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.02E-15	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	9.47E-09	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	1.12E-14	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	1.24E-08	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	9.16E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.56E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	1.78E-14	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	1.04E-08	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.90E-07	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	9.72E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.94E-16	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	4.90E-10	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.48E-06	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	6.47E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	8.33E-07	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	4.36E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	8.80E-07	2.14E-11	mr1268_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	1.96E-11	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	4.43E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.01E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	3.26E-10	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	2.09E-12	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	3.93E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	1.72E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	3.34E-13	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	7.08E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	9.72E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	8.96E-11	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	1.28E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	3.44E-09	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	3.42E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	4.05E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133673919	NA	4.42E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251