Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133596348:

Variant ID: vg0133596348 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33596348
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, G: 0.28, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTACTGTTCCATTCTGCCAACCTTTCAATTTGTGCATATCTTTAAGTTCGTATTAACTGTAGCATAGGTGTAATTTAGTTTTGTTTTTTCTTCATGTT[A/G]
CATGTTTGACTACATTTGGTTTGTGATGCCAAATGGCCTGAATTAGTCAAACCGAAATAGTCTGTATTTTCCAGAAAAAAAGCAAGCAACTTTATTTTTA

Reverse complement sequence

TAAAAATAAAGTTGCTTGCTTTTTTTCTGGAAAATACAGACTATTTCGGTTTGACTAATTCAGGCCATTTGGCATCACAAACCAAATGTAGTCAAACATG[T/C]
AACATGAAGAAAAAACAAAACTAAATTACACCTATGCTACAGTTAATACGAACTTAAAGATATGCACAAATTGAAAGGTTGGCAGAATGGAACAGTAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 37.10% 0.02% 0.00% NA
All Indica  2759 95.50% 4.50% 0.00% 0.00% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133596348 A -> G LOC_Os01g58070.1 upstream_gene_variant ; 4687.0bp to feature; MODIFIER silent_mutation Average:36.06; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0133596348 A -> G LOC_Os01g58100.1 downstream_gene_variant ; 4982.0bp to feature; MODIFIER silent_mutation Average:36.06; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0133596348 A -> G LOC_Os01g58080.1 intron_variant ; MODIFIER silent_mutation Average:36.06; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0133596348 A -> G LOC_Os01g58080.2 intron_variant ; MODIFIER silent_mutation Average:36.06; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0133596348 A -> G LOC_Os01g58080.3 intron_variant ; MODIFIER silent_mutation Average:36.06; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133596348 NA 3.49E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 1.31E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 7.46E-33 3.53E-169 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 6.94E-32 2.07E-165 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 1.94E-19 5.05E-102 mr1014 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 1.54E-18 3.77E-103 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 4.88E-57 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 8.35E-73 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 5.46E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 5.79E-74 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 3.94E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 6.04E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 1.88E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 2.31E-85 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 1.85E-88 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 4.85E-69 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 6.36E-58 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 3.73E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 5.05E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 6.29E-100 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 1.22E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 1.79E-39 1.09E-172 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 4.80E-25 6.80E-122 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 2.35E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 1.79E-13 6.17E-92 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 3.61E-07 2.31E-29 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 7.27E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 4.77E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 5.05E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 6.41E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 NA 1.82E-46 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133596348 3.31E-09 1.23E-73 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251