\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133595333:

Variant ID: vg0133595333 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33595333
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGAGATCCTCTAACTTACTTCCCTTCGACGCCAGTCACTGAAATGTGTACCCTCTAACCAACGGGCCCACATGTCTGTGACTCAAAGTCAAAGGGAA[G/C]
TAAGTCAGAGGATCCTCTTCCATTTGAGAGAAGTACCTGTCGCTACGGTTTTCTCTTTTAATCCATTTAGATGAAAGATAACGCTTGAATAAAAGTATAC

Reverse complement sequence

GTATACTTTTATTCAAGCGTTATCTTTCATCTAAATGGATTAAAAGAGAAAACCGTAGCGACAGGTACTTCTCTCAAATGGAAGAGGATCCTCTGACTTA[C/G]
TTCCCTTTGACTTTGAGTCACAGACATGTGGGCCCGTTGGTTAGAGGGTACACATTTCAGTGACTGGCGTCGAAGGGAAGTAAGTTAGAGGATCTCAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.70% 0.13% 0.06% NA
All Indica  2759 95.00% 4.70% 0.22% 0.11% NA
All Japonica  1512 1.20% 98.80% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 93.30% 6.60% 0.17% 0.00% NA
Indica II  465 97.80% 1.70% 0.22% 0.22% NA
Indica III  913 97.00% 2.50% 0.33% 0.11% NA
Indica Intermediate  786 92.10% 7.60% 0.13% 0.13% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 31.10% 68.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133595333 G -> DEL N N silent_mutation Average:50.788; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg0133595333 G -> C LOC_Os01g58070.1 upstream_gene_variant ; 3672.0bp to feature; MODIFIER silent_mutation Average:50.788; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg0133595333 G -> C LOC_Os01g58080.1 intron_variant ; MODIFIER silent_mutation Average:50.788; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg0133595333 G -> C LOC_Os01g58080.2 intron_variant ; MODIFIER silent_mutation Average:50.788; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg0133595333 G -> C LOC_Os01g58080.3 intron_variant ; MODIFIER silent_mutation Average:50.788; most accessible tissue: Minghui63 root, score: 76.119 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133595333 1.41E-06 1.63E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 4.56E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 1.26E-34 1.57E-174 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 2.80E-33 5.17E-170 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 2.26E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 1.95E-16 4.21E-99 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 1.41E-16 4.14E-101 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 4.01E-70 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 2.44E-06 4.81E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 5.92E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 1.79E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 3.70E-89 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 1.07E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 3.49E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 1.03E-10 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 5.33E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 NA 1.91E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 1.58E-42 1.77E-178 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 5.37E-27 1.90E-124 mr1015_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 4.18E-12 9.04E-91 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 7.32E-09 1.62E-30 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 2.51E-07 5.06E-95 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133595333 9.84E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251