\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133592451:

Variant ID: vg0133592451 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33592451
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTCTCCATCTCACCATTCATGAAATTAAAATAAACCCCAATGATAATCATATTTGATTTTTAAAATCGCAATGATAATAAAAATGAGAGGCAGCGGG[C/T]
GGGTCGTACATGAGTACAATGGCAGAGCCGCCGATGATTGGTGTGACTTCTAGAAAGTAAAAAAAAAATTCCAACGATAGTTATGTTCGATTTTTAGAAC

Reverse complement sequence

GTTCTAAAAATCGAACATAACTATCGTTGGAATTTTTTTTTTACTTTCTAGAAGTCACACCAATCATCGGCGGCTCTGCCATTGTACTCATGTACGACCC[G/A]
CCCGCTGCCTCTCATTTTTATTATCATTGCGATTTTAAAAATCAAATATGATTATCATTGGGGTTTATTTTAATTTCATGAATGGTGAGATGGAGAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.00% 10.10% 22.05% 28.90% NA
All Indica  2759 7.10% 15.10% 33.56% 44.26% NA
All Japonica  1512 97.80% 0.00% 1.32% 0.93% NA
Aus  269 3.30% 21.20% 32.71% 42.75% NA
Indica I  595 10.60% 12.60% 38.49% 38.32% NA
Indica II  465 4.10% 3.00% 6.67% 86.24% NA
Indica III  913 3.50% 26.50% 45.89% 24.10% NA
Indica Intermediate  786 10.30% 10.90% 31.42% 47.33% NA
Temperate Japonica  767 96.50% 0.00% 2.48% 1.04% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 73.30% 2.20% 8.89% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133592451 C -> T LOC_Os01g58070.1 upstream_gene_variant ; 790.0bp to feature; MODIFIER silent_mutation Average:46.266; most accessible tissue: Callus, score: 73.773 N N N N
vg0133592451 C -> T LOC_Os01g58080.1 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:46.266; most accessible tissue: Callus, score: 73.773 N N N N
vg0133592451 C -> T LOC_Os01g58080.2 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:46.266; most accessible tissue: Callus, score: 73.773 N N N N
vg0133592451 C -> T LOC_Os01g58080.3 upstream_gene_variant ; 1346.0bp to feature; MODIFIER silent_mutation Average:46.266; most accessible tissue: Callus, score: 73.773 N N N N
vg0133592451 C -> T LOC_Os01g58070-LOC_Os01g58080 intergenic_region ; MODIFIER silent_mutation Average:46.266; most accessible tissue: Callus, score: 73.773 N N N N
vg0133592451 C -> DEL N N silent_mutation Average:46.266; most accessible tissue: Callus, score: 73.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133592451 9.66E-15 8.00E-121 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 4.23E-07 8.55E-12 mr1008 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 7.50E-15 5.75E-120 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 1.20E-07 2.86E-12 mr1009 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 3.18E-08 2.67E-78 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 1.60E-07 1.34E-77 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 NA 9.57E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 NA 2.72E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 NA 2.62E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 NA 1.31E-09 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 3.41E-17 5.34E-119 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 NA 1.50E-09 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 2.25E-11 1.05E-91 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 5.79E-07 NA mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451 NA 7.86E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251