Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133592451:

Variant ID: vg0133592451 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33592451
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTTCTCCATCTCACCATTCATGAAATTAAAATAAACCCCAATGATAATCATATTTGATTTTTAAAATCGCAATGATAATAAAAATGAGAGGCAGCGGG[C/T]
GGGTCGTACATGAGTACAATGGCAGAGCCGCCGATGATTGGTGTGACTTCTAGAAAGTAAAAAAAAAATTCCAACGATAGTTATGTTCGATTTTTAGAAC

Reverse complement sequence

GTTCTAAAAATCGAACATAACTATCGTTGGAATTTTTTTTTTACTTTCTAGAAGTCACACCAATCATCGGCGGCTCTGCCATTGTACTCATGTACGACCC[G/A]
CCCGCTGCCTCTCATTTTTATTATCATTGCGATTTTAAAAATCAAATATGATTATCATTGGGGTTTATTTTAATTTCATGAATGGTGAGATGGAGAAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	10.10%	22.05%	28.90%	NA
All Indica	2759	7.10%	15.10%	33.56%	44.26%	NA
All Japonica	1512	97.80%	0.00%	1.32%	0.93%	NA
Aus	269	3.30%	21.20%	32.71%	42.75%	NA
Indica I	595	10.60%	12.60%	38.49%	38.32%	NA
Indica II	465	4.10%	3.00%	6.67%	86.24%	NA
Indica III	913	3.50%	26.50%	45.89%	24.10%	NA
Indica Intermediate	786	10.30%	10.90%	31.42%	47.33%	NA
Temperate Japonica	767	96.50%	0.00%	2.48%	1.04%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	73.30%	2.20%	8.89%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133592451	C -> T	LOC_Os01g58070.1	upstream_gene_variant ; 790.0bp to feature; MODIFIER	silent_mutation	Average:46.266; most accessible tissue: Callus, score: 73.773	N	N	N	N
vg0133592451	C -> T	LOC_Os01g58080.1	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:46.266; most accessible tissue: Callus, score: 73.773	N	N	N	N
vg0133592451	C -> T	LOC_Os01g58080.2	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:46.266; most accessible tissue: Callus, score: 73.773	N	N	N	N
vg0133592451	C -> T	LOC_Os01g58080.3	upstream_gene_variant ; 1346.0bp to feature; MODIFIER	silent_mutation	Average:46.266; most accessible tissue: Callus, score: 73.773	N	N	N	N
vg0133592451	C -> T	LOC_Os01g58070-LOC_Os01g58080	intergenic_region ; MODIFIER	silent_mutation	Average:46.266; most accessible tissue: Callus, score: 73.773	N	N	N	N
vg0133592451	C -> DEL	N	N	silent_mutation	Average:46.266; most accessible tissue: Callus, score: 73.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133592451	9.66E-15	8.00E-121	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	4.23E-07	8.55E-12	mr1008	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	7.50E-15	5.75E-120	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	1.20E-07	2.86E-12	mr1009	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	3.18E-08	2.67E-78	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	1.60E-07	1.34E-77	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	NA	9.57E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	NA	2.72E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	NA	2.62E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	NA	1.31E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	3.41E-17	5.34E-119	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	NA	1.50E-09	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	2.25E-11	1.05E-91	mr1015_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	5.79E-07	NA	mr1027_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133592451	NA	7.86E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251