Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0133434075:

Variant ID: vg0133434075 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33434075
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

CGACCAATAATCAAGCTGAGTATGAAGCGGTGCTCAAGGGGTTGCAATTACTCAAGGAAGTTGAAGTTGATACCATTGAAATCATGGGGGATTCTTTGCT[G/A]
GTAATCAGTCAATTGGCATGAGAATATGAATGCAAGAACGATACGTTGATGGTTTATAATGAGAAGTGCTTGGAACTAATGAAAGAGTTTCGGCTGGTTA

Reverse complement sequence

TAACCAGCCGAAACTCTTTCATTAGTTCCAAGCACTTCTCATTATAAACCATCAACGTATCGTTCTTGCATTCATATTCTCATGCCAATTGACTGATTAC[C/T]
AGCAAAGAATCCCCCATGATTTCAATGGTATCAACTTCAACTTCCTTGAGTAATTGCAACCCCTTGAGCACCGCTTCATACTCAGCTTGATTATTGGTCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.10%	39.10%	0.76%	0.04%	NA
All Indica	2759	92.00%	6.90%	1.05%	0.07%	NA
All Japonica	1512	1.10%	98.90%	0.07%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	90.40%	7.60%	2.02%	0.00%	NA
Indica II	465	94.60%	4.30%	1.08%	0.00%	NA
Indica III	913	93.90%	5.80%	0.33%	0.00%	NA
Indica Intermediate	786	89.30%	9.30%	1.15%	0.25%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	4.20%	93.80%	2.08%	0.00%	NA
Intermediate	90	24.40%	71.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133434075	G -> A	LOC_Os01g57800.1	splice_region_variant&synonymous_variant ; p.Leu1376Leu; LOW	synonymous_codon	Average:25.877; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0133434075	G -> DEL	LOC_Os01g57800.1	N	frameshift_variant	Average:25.877; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133434075	1.02E-07	2.96E-104	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	NA	3.77E-09	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	8.77E-08	5.26E-102	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	NA	1.81E-08	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	9.76E-07	NA	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	6.00E-09	NA	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	1.54E-09	1.79E-13	mr1008_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	3.23E-06	NA	mr1015_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	NA	2.34E-06	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133434075	NA	9.08E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251