Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0133432234:

Variant ID: vg0133432234 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33432234
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TGCCAGTGCCGATTTAGCCCTTTAGGAGATGGATGGCCTTGATTGTTTATCTGGAAAAGTCTGGGATGGAGATTTTCTAAAAGTGTCCGATTCTGATATA[T/C]
AGCCAATCGAAGATGGAGAACCCAAGCTATTACTTTGAGGGCGTCGTGGAGGGTTCAAATGTCTACGCTAAGGATACAGTTGATGATCTCGATGACAAGC

Reverse complement sequence

GCTTGTCATCGAGATCATCAACTGTATCCTTAGCGTAGACATTTGAACCCTCCACGACGCCCTCAAAGTAATAGCTTGGGTTCTCCATCTTCGATTGGCT[A/G]
TATATCAGAATCGGACACTTTTAGAAAATCTCCATCCCAGACTTTTCCAGATAAACAATCAAGGCCATCCATCTCCTAAAGGGCTAAATCGGCACTGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	37.40%	2.67%	1.86%	NA
All Indica	2759	92.90%	5.40%	1.30%	0.36%	NA
All Japonica	1512	3.80%	96.20%	0.00%	0.00%	NA
Aus	269	34.90%	4.10%	32.34%	28.62%	NA
Indica I	595	92.60%	7.20%	0.17%	0.00%	NA
Indica II	465	94.60%	2.60%	2.80%	0.00%	NA
Indica III	913	96.60%	3.20%	0.22%	0.00%	NA
Indica Intermediate	786	87.90%	8.30%	2.54%	1.27%	NA
Temperate Japonica	767	5.90%	94.10%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	93.80%	1.04%	0.00%	NA
Intermediate	90	25.60%	71.10%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133432234	T -> DEL	N	N	silent_mutation	Average:28.894; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0133432234	T -> C	LOC_Os01g57800.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:28.894; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0133432234	T -> C	LOC_Os01g57810.1	downstream_gene_variant ; 3635.0bp to feature; MODIFIER	silent_mutation	Average:28.894; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133432234	2.78E-12	NA	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	4.90E-07	7.15E-12	mr1008	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	3.07E-12	NA	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	3.41E-07	9.42E-12	mr1009	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	5.25E-06	NA	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	NA	2.86E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	1.52E-12	NA	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	NA	5.84E-11	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	8.64E-08	NA	mr1015_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133432234	8.70E-06	5.21E-28	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251