Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0133426880:

Variant ID: vg0133426880 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33426880
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTGTAATCTGTGGTTCTTTCCATATAATCCCATATCAACTGGATTAGGGCTATTACCTGCTAAGGGGCCTGAACCAGTATAATCTTTGTCTCTTGTTT[C/T]
CTTGATGTCGTATTACATAGATCCTCGTACCAGCGTACCCCAGTACCCTCGATATCCTGTCTACGGGTATACCCCGTCGACAATATTTTTCTATCTAGAA

Reverse complement sequence

TTCTAGATAGAAAAATATTGTCGACGGGGTATACCCGTAGACAGGATATCGAGGGTACTGGGGTACGCTGGTACGAGGATCTATGTAATACGACATCAAG[G/A]
AAACAAGAGACAAAGATTATACTGGTTCAGGCCCCTTAGCAGGTAATAGCCCTAATCCAGTTGATATGGGATTATATGGAAAGAACCACAGATTACAAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.30%	43.50%	0.13%	0.00%	NA
All Indica	2759	91.70%	8.00%	0.22%	0.00%	NA
All Japonica	1512	1.10%	98.90%	0.00%	0.00%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	92.30%	7.40%	0.34%	0.00%	NA
Indica II	465	97.20%	2.60%	0.22%	0.00%	NA
Indica III	913	91.80%	8.00%	0.22%	0.00%	NA
Indica Intermediate	786	88.00%	11.80%	0.13%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	25.60%	74.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133426880	C -> T	LOC_Os01g57800.1	upstream_gene_variant ; 1721.0bp to feature; MODIFIER	silent_mutation	Average:42.071; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0133426880	C -> T	LOC_Os01g57790.1	downstream_gene_variant ; 157.0bp to feature; MODIFIER	silent_mutation	Average:42.071; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0133426880	C -> T	LOC_Os01g57790-LOC_Os01g57800	intergenic_region ; MODIFIER	silent_mutation	Average:42.071; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133426880	NA	4.32E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	3.93E-08	NA	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	3.93E-06	1.21E-09	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	7.23E-09	NA	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	1.06E-06	1.47E-09	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	1.82E-08	NA	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	2.11E-07	1.16E-13	mr1008_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	NA	3.41E-06	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	NA	2.98E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	NA	3.01E-08	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133426880	NA	1.33E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251