Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133420260:

Variant ID: vg0133420260 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33420260
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.42, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAGCTGGCAGTCCAATACGACAAGTGGAGCCTCAACATGGTCGAGCACACTCCCAGCCCACCCGCCACAGCCGAGCCACCCAAGAAAGTGATCAAAAC[A/G]
ACTAAGACGCCGAAACCAGACGGCGCAATCAAAATCGTCCCACTCTCCAGTGCCAACCCCGACAAGACGGTCAAGATCGGGGCATCACTGAACGAGAAAT

Reverse complement sequence

ATTTCTCGTTCAGTGATGCCCCGATCTTGACCGTCTTGTCGGGGTTGGCACTGGAGAGTGGGACGATTTTGATTGCGCCGTCTGGTTTCGGCGTCTTAGT[T/C]
GTTTTGATCACTTTCTTGGGTGGCTCGGCTGTGGCGGGTGGGCTGGGAGTGTGCTCGACCATGTTGAGGCTCCACTTGTCGTATTGGACTGCCAGCTTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	37.80%	3.62%	0.04%	NA
All Indica	2759	94.30%	4.70%	0.91%	0.00%	NA
All Japonica	1512	1.10%	98.90%	0.00%	0.00%	NA
Aus	269	42.80%	2.60%	53.90%	0.74%	NA
Indica I	595	92.90%	6.40%	0.67%	0.00%	NA
Indica II	465	97.60%	2.20%	0.22%	0.00%	NA
Indica III	913	97.30%	2.50%	0.22%	0.00%	NA
Indica Intermediate	786	90.10%	7.60%	2.29%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	28.90%	70.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133420260	A -> G	LOC_Os01g57780.1	synonymous_variant ; p.Thr785Thr; LOW	synonymous_codon	Average:42.814; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0133420260	A -> G	LOC_Os01g57780.1	synonymous_variant ; p.Thr785Thr; LOW	nonsynonymous_codon ; T785M	Average:42.814; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	probably damaging	2.771	TOLERATED	0.41
vg0133420260	A -> DEL	LOC_Os01g57780.1	N	frameshift_variant	Average:42.814; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133420260	2.46E-10	5.43E-107	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	1.09E-08	1.61E-13	mr1008	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	2.16E-10	1.16E-105	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	7.71E-09	3.55E-13	mr1009	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	1.04E-07	6.86E-72	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	5.78E-06	1.92E-07	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	1.94E-07	NA	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	5.90E-06	2.78E-07	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	NA	7.47E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	NA	9.02E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	NA	8.37E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	NA	5.34E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133420260	NA	6.90E-08	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251