\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133400564:

Variant ID: vg0133400564 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33400564
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCAGAATTTTTTTATAAACGCGGGATTTTTCTCACGTTGGGTCAGTTTTTTCGGGGTAGTATTTTTTATATATGGCGGTTTTTTCTCGTGTGAATTC[G/A]
GATGGTTTTTTCTATCTTTTTTTAGCAATGTTTTTTCTGATGGTTTATTTCGGACAAATAGAGCCTCAGTGCACTCTTCTTAATAAAAATTAAAAATATG

Reverse complement sequence

CATATTTTTAATTTTTATTAAGAAGAGTGCACTGAGGCTCTATTTGTCCGAAATAAACCATCAGAAAAAACATTGCTAAAAAAAGATAGAAAAAACCATC[C/T]
GAATTCACACGAGAAAAAACCGCCATATATAAAAAATACTACCCCGAAAAAACTGACCCAACGTGAGAAAAATCCCGCGTTTATAAAAAAATTCTGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.60% 6.30% 11.19% 38.87% NA
All Indica  2759 7.90% 8.60% 18.38% 65.10% NA
All Japonica  1512 99.00% 0.00% 0.00% 0.99% NA
Aus  269 67.30% 22.70% 6.69% 3.35% NA
Indica I  595 6.60% 4.40% 22.52% 66.55% NA
Indica II  465 2.20% 0.60% 7.10% 90.11% NA
Indica III  913 8.20% 16.30% 22.34% 53.12% NA
Indica Intermediate  786 12.10% 7.50% 17.30% 63.10% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 99.00% 0.00% 0.00% 0.99% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 76.70% 2.20% 4.44% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133400564 G -> A LOC_Os01g57740.1 downstream_gene_variant ; 4473.0bp to feature; MODIFIER silent_mutation Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0133400564 G -> A LOC_Os01g57750.1 downstream_gene_variant ; 2851.0bp to feature; MODIFIER silent_mutation Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0133400564 G -> A LOC_Os01g57760.1 downstream_gene_variant ; 3669.0bp to feature; MODIFIER silent_mutation Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0133400564 G -> A LOC_Os01g57750-LOC_Os01g57760 intergenic_region ; MODIFIER silent_mutation Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N
vg0133400564 G -> DEL N N silent_mutation Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133400564 NA 3.95E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 2.76E-06 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 NA 1.94E-08 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 1.47E-06 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 4.98E-06 3.07E-08 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 1.46E-06 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 1.52E-08 6.12E-11 mr1008_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 NA 3.71E-10 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 NA 5.53E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 NA 5.60E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564 NA 1.47E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251