\
| Variant ID: vg0133400564 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33400564 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )
GAATCAGAATTTTTTTATAAACGCGGGATTTTTCTCACGTTGGGTCAGTTTTTTCGGGGTAGTATTTTTTATATATGGCGGTTTTTTCTCGTGTGAATTC[G/A]
GATGGTTTTTTCTATCTTTTTTTAGCAATGTTTTTTCTGATGGTTTATTTCGGACAAATAGAGCCTCAGTGCACTCTTCTTAATAAAAATTAAAAATATG
CATATTTTTAATTTTTATTAAGAAGAGTGCACTGAGGCTCTATTTGTCCGAAATAAACCATCAGAAAAAACATTGCTAAAAAAAGATAGAAAAAACCATC[C/T]
GAATTCACACGAGAAAAAACCGCCATATATAAAAAATACTACCCCGAAAAAACTGACCCAACGTGAGAAAAATCCCGCGTTTATAAAAAAATTCTGATTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 6.30% | 11.19% | 38.87% | NA |
| All Indica | 2759 | 7.90% | 8.60% | 18.38% | 65.10% | NA |
| All Japonica | 1512 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Aus | 269 | 67.30% | 22.70% | 6.69% | 3.35% | NA |
| Indica I | 595 | 6.60% | 4.40% | 22.52% | 66.55% | NA |
| Indica II | 465 | 2.20% | 0.60% | 7.10% | 90.11% | NA |
| Indica III | 913 | 8.20% | 16.30% | 22.34% | 53.12% | NA |
| Indica Intermediate | 786 | 12.10% | 7.50% | 17.30% | 63.10% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 76.70% | 2.20% | 4.44% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133400564 | G -> A | LOC_Os01g57740.1 | downstream_gene_variant ; 4473.0bp to feature; MODIFIER | silent_mutation | Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0133400564 | G -> A | LOC_Os01g57750.1 | downstream_gene_variant ; 2851.0bp to feature; MODIFIER | silent_mutation | Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0133400564 | G -> A | LOC_Os01g57760.1 | downstream_gene_variant ; 3669.0bp to feature; MODIFIER | silent_mutation | Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0133400564 | G -> A | LOC_Os01g57750-LOC_Os01g57760 | intergenic_region ; MODIFIER | silent_mutation | Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0133400564 | G -> DEL | N | N | silent_mutation | Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133400564 | NA | 3.95E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | 2.76E-06 | NA | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | NA | 1.94E-08 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | 1.47E-06 | NA | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | 4.98E-06 | 3.07E-08 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | 1.46E-06 | NA | mr1008_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | 1.52E-08 | 6.12E-11 | mr1008_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | NA | 3.71E-10 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | NA | 5.53E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | NA | 5.60E-11 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133400564 | NA | 1.47E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |