\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133271810:

Variant ID: vg0133271810 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33271810
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAGCATTTCCAACATTCATATTGATGTTAATGAATCATTCATATTGATGTTAATGAATCTAACATCAATATGAATGTGGGAAATGCTAGAATGACTTA[C/T]
ATTGTGAAACGGAGGGAGTATATCATTGTTTAATTAAAGACGGTTTATGCTACAGATTAACACCAATTATGTTCATGATGACTATATTGTCAGTCATCTG

Reverse complement sequence

CAGATGACTGACAATATAGTCATCATGAACATAATTGGTGTTAATCTGTAGCATAAACCGTCTTTAATTAAACAATGATATACTCCCTCCGTTTCACAAT[G/A]
TAAGTCATTCTAGCATTTCCCACATTCATATTGATGTTAGATTCATTAACATCAATATGAATGATTCATTAACATCAATATGAATGTTGGAAATGCTAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.10% 1.48% 0.00% NA
All Indica  2759 95.60% 1.90% 2.54% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.70% 6.40% 9.92% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 97.30% 1.50% 1.15% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133271810 C -> T LOC_Os01g57570.1 downstream_gene_variant ; 3366.0bp to feature; MODIFIER silent_mutation Average:36.48; most accessible tissue: Callus, score: 56.41 N N N N
vg0133271810 C -> T LOC_Os01g57580.1 downstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:36.48; most accessible tissue: Callus, score: 56.41 N N N N
vg0133271810 C -> T LOC_Os01g57570.2 downstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:36.48; most accessible tissue: Callus, score: 56.41 N N N N
vg0133271810 C -> T LOC_Os01g57570-LOC_Os01g57580 intergenic_region ; MODIFIER silent_mutation Average:36.48; most accessible tissue: Callus, score: 56.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133271810 1.12E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0133271810 1.25E-06 NA Plant_height Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0133271810 NA 1.25E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133271810 NA 2.19E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133271810 NA 8.56E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251