\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133243522:

Variant ID: vg0133243522 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33243522
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCAAAGCTCTGCTGAAACTAGTTCACTTATAACGAGTCTTGAAAACTTGTAAGTTGTAAGACCACATTAGACAAGGTCATGATTGTTGCAATGCACTA[G/A]
TTGTAGGTTAGAGACATTGTCTGGCGTGTGATGGAGCCGACAAAACTGGTTAAATGATTTGTGTAAAAGGCTAACAGTATTTAAGCATCATTTCTTATCG

Reverse complement sequence

CGATAAGAAATGATGCTTAAATACTGTTAGCCTTTTACACAAATCATTTAACCAGTTTTGTCGGCTCCATCACACGCCAGACAATGTCTCTAACCTACAA[C/T]
TAGTGCATTGCAACAATCATGACCTTGTCTAATGTGGTCTTACAACTTACAAGTTTTCAAGACTCGTTATAAGTGAACTAGTTTCAGCAGAGCTTTGCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 39.90% 0.21% 0.02% NA
All Indica  2759 93.60% 6.20% 0.22% 0.04% NA
All Japonica  1512 7.50% 92.50% 0.00% 0.00% NA
Aus  269 37.50% 62.50% 0.00% 0.00% NA
Indica I  595 92.90% 6.90% 0.17% 0.00% NA
Indica II  465 97.20% 2.20% 0.65% 0.00% NA
Indica III  913 95.70% 4.30% 0.00% 0.00% NA
Indica Intermediate  786 89.40% 10.20% 0.25% 0.13% NA
Temperate Japonica  767 11.00% 89.00% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 26.70% 68.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133243522 G -> A LOC_Os01g57540.1 3_prime_UTR_variant ; 168.0bp to feature; MODIFIER silent_mutation Average:61.337; most accessible tissue: Callus, score: 88.303 N N N N
vg0133243522 G -> A LOC_Os01g57550.1 upstream_gene_variant ; 1220.0bp to feature; MODIFIER silent_mutation Average:61.337; most accessible tissue: Callus, score: 88.303 N N N N
vg0133243522 G -> A LOC_Os01g57550.2 upstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:61.337; most accessible tissue: Callus, score: 88.303 N N N N
vg0133243522 G -> DEL N N silent_mutation Average:61.337; most accessible tissue: Callus, score: 88.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133243522 NA 4.27E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 2.27E-13 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 4.07E-14 3.62E-21 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 1.35E-13 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 3.35E-14 2.56E-20 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 2.39E-07 NA mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 4.64E-07 8.09E-09 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 4.99E-06 NA mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 NA 5.24E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 NA 1.36E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 NA 9.05E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 NA 1.64E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 7.97E-17 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 1.83E-18 3.99E-28 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 3.89E-10 NA mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 3.40E-08 1.09E-11 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 1.92E-06 NA mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 2.40E-07 2.07E-09 mr1027_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 NA 3.62E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 NA 4.63E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 NA 3.20E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133243522 NA 3.96E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251