\
| Variant ID: vg0133231306 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33231306 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )
AGACTTAACACATGAGTTGGTTTTCCAGTGGCTACATGTCCCCGGAGTATGCAATGGACGGCGTGTTCTCCATGAAATCCGATGTCTATAGCTTTGGTGT[C/T]
CTAGTGCTAGAGATCGTCACTGGCAGACGGAACCGAGGATTCTACGAAGCCGAGCTCGATCTCAACCTCCTCAGATACGTAAGTAACGTTAGCTATTAAT
ATTAATAGCTAACGTTACTTACGTATCTGAGGAGGTTGAGATCGAGCTCGGCTTCGTAGAATCCTCGGTTCCGTCTGCCAGTGACGATCTCTAGCACTAG[G/A]
ACACCAAAGCTATAGACATCGGATTTCATGGAGAACACGCCGTCCATTGCATACTCCGGGGACATGTAGCCACTGGAAAACCAACTCATGTGTTAAGTCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.20% | 48.60% | 0.15% | 0.04% | NA |
| All Indica | 2759 | 86.10% | 13.70% | 0.18% | 0.07% | NA |
| All Japonica | 1512 | 1.10% | 98.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 92.60% | 7.10% | 0.17% | 0.17% | NA |
| Indica II | 465 | 80.20% | 19.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 90.60% | 9.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 79.40% | 20.40% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 1.00% | 98.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 17.80% | 82.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133231306 | C -> T | LOC_Os01g57510.1 | synonymous_variant ; p.Val732Val; LOW | synonymous_codon | Average:65.026; most accessible tissue: Callus, score: 82.414 | N | N | N | N |
| vg0133231306 | C -> DEL | LOC_Os01g57510.1 | N | frameshift_variant | Average:65.026; most accessible tissue: Callus, score: 82.414 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133231306 | NA | 6.44E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 3.14E-12 | NA | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 3.81E-10 | 2.63E-13 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 7.77E-12 | NA | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 1.34E-09 | 2.08E-12 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 1.78E-06 | NA | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 5.67E-07 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 3.65E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 5.90E-07 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 1.70E-10 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 4.23E-07 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 6.16E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 3.56E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 1.09E-09 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 2.73E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 4.28E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 4.74E-08 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 6.81E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 7.73E-10 | NA | mr1008_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 1.54E-11 | 6.94E-14 | mr1008_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 2.07E-07 | NA | mr1015_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | 3.81E-06 | 8.66E-07 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133231306 | NA | 1.14E-09 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |