\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133223996:

Variant ID: vg0133223996 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33223996
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GACCTCAACAAGCTCCATAAATTGAAGGTATTATAGGAATGCTTGCATACCCAAAGCTCCGGAGCATTCCCTAACCCATTGCTGATTGTGCAGAGCTTCA[G/A]
CCACCGTTCTACGGCGACGGATCCTCACAGGACTGCCGCAAAGACAGCCGGGGCGATGCAACGGATGGATGAGGCCTCCAGCCAGTTGTCCATCCAAAAG

Reverse complement sequence

CTTTTGGATGGACAACTGGCTGGAGGCCTCATCCATCCGTTGCATCGCCCCGGCTGTCTTTGCGGCAGTCCTGTGAGGATCCGTCGCCGTAGAACGGTGG[C/T]
TGAAGCTCTGCACAATCAGCAATGGGTTAGGGAATGCTCCGGAGCTTTGGGTATGCAAGCATTCCTATAATACCTTCAATTTATGGAGCTTGTTGAGGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.70% 0.19% 0.08% NA
All Indica  2759 90.50% 9.20% 0.18% 0.14% NA
All Japonica  1512 7.80% 92.10% 0.07% 0.00% NA
Aus  269 37.50% 62.50% 0.00% 0.00% NA
Indica I  595 92.60% 6.70% 0.34% 0.34% NA
Indica II  465 97.60% 2.20% 0.22% 0.00% NA
Indica III  913 86.30% 13.60% 0.00% 0.11% NA
Indica Intermediate  786 89.40% 10.20% 0.25% 0.13% NA
Temperate Japonica  767 11.60% 88.30% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 7.10% 92.90% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 26.70% 70.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133223996 G -> A LOC_Os01g57500.1 upstream_gene_variant ; 56.0bp to feature; MODIFIER silent_mutation Average:62.588; most accessible tissue: Callus, score: 82.736 N N N N
vg0133223996 G -> A LOC_Os01g57510.1 upstream_gene_variant ; 3656.0bp to feature; MODIFIER silent_mutation Average:62.588; most accessible tissue: Callus, score: 82.736 N N N N
vg0133223996 G -> A LOC_Os01g57490.1 downstream_gene_variant ; 252.0bp to feature; MODIFIER silent_mutation Average:62.588; most accessible tissue: Callus, score: 82.736 N N N N
vg0133223996 G -> A LOC_Os01g57490-LOC_Os01g57500 intergenic_region ; MODIFIER silent_mutation Average:62.588; most accessible tissue: Callus, score: 82.736 N N N N
vg0133223996 G -> DEL N N silent_mutation Average:62.588; most accessible tissue: Callus, score: 82.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133223996 NA 5.75E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 3.72E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 4.77E-16 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 2.02E-23 1.58E-30 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 1.05E-16 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 1.53E-24 2.05E-30 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 1.44E-07 NA mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 3.09E-08 9.23E-11 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 2.72E-06 NA mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 9.26E-07 1.50E-08 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 4.70E-24 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 1.11E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 1.51E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 1.91E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 2.46E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 2.95E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 3.82E-19 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 1.77E-28 2.27E-35 mr1008_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 6.69E-09 NA mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 8.59E-08 8.52E-12 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 1.58E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 1.88E-27 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 1.85E-07 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996 NA 2.99E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251