Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133223996:

Variant ID: vg0133223996 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33223996
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GACCTCAACAAGCTCCATAAATTGAAGGTATTATAGGAATGCTTGCATACCCAAAGCTCCGGAGCATTCCCTAACCCATTGCTGATTGTGCAGAGCTTCA[G/A]
CCACCGTTCTACGGCGACGGATCCTCACAGGACTGCCGCAAAGACAGCCGGGGCGATGCAACGGATGGATGAGGCCTCCAGCCAGTTGTCCATCCAAAAG

Reverse complement sequence

CTTTTGGATGGACAACTGGCTGGAGGCCTCATCCATCCGTTGCATCGCCCCGGCTGTCTTTGCGGCAGTCCTGTGAGGATCCGTCGCCGTAGAACGGTGG[C/T]
TGAAGCTCTGCACAATCAGCAATGGGTTAGGGAATGCTCCGGAGCTTTGGGTATGCAAGCATTCCTATAATACCTTCAATTTATGGAGCTTGTTGAGGTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	41.70%	0.19%	0.08%	NA
All Indica	2759	90.50%	9.20%	0.18%	0.14%	NA
All Japonica	1512	7.80%	92.10%	0.07%	0.00%	NA
Aus	269	37.50%	62.50%	0.00%	0.00%	NA
Indica I	595	92.60%	6.70%	0.34%	0.34%	NA
Indica II	465	97.60%	2.20%	0.22%	0.00%	NA
Indica III	913	86.30%	13.60%	0.00%	0.11%	NA
Indica Intermediate	786	89.40%	10.20%	0.25%	0.13%	NA
Temperate Japonica	767	11.60%	88.30%	0.13%	0.00%	NA
Tropical Japonica	504	2.40%	97.60%	0.00%	0.00%	NA
Japonica Intermediate	241	7.10%	92.90%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	26.70%	70.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133223996	G -> A	LOC_Os01g57500.1	upstream_gene_variant ; 56.0bp to feature; MODIFIER	silent_mutation	Average:62.588; most accessible tissue: Callus, score: 82.736	N	N	N	N
vg0133223996	G -> A	LOC_Os01g57510.1	upstream_gene_variant ; 3656.0bp to feature; MODIFIER	silent_mutation	Average:62.588; most accessible tissue: Callus, score: 82.736	N	N	N	N
vg0133223996	G -> A	LOC_Os01g57490.1	downstream_gene_variant ; 252.0bp to feature; MODIFIER	silent_mutation	Average:62.588; most accessible tissue: Callus, score: 82.736	N	N	N	N
vg0133223996	G -> A	LOC_Os01g57490-LOC_Os01g57500	intergenic_region ; MODIFIER	silent_mutation	Average:62.588; most accessible tissue: Callus, score: 82.736	N	N	N	N
vg0133223996	G -> DEL	N	N	silent_mutation	Average:62.588; most accessible tissue: Callus, score: 82.736	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133223996	NA	5.75E-24	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	3.72E-06	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	4.77E-16	NA	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	2.02E-23	1.58E-30	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	1.05E-16	NA	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	1.53E-24	2.05E-30	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	1.44E-07	NA	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	3.09E-08	9.23E-11	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	2.72E-06	NA	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	9.26E-07	1.50E-08	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	4.70E-24	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	1.11E-06	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	1.51E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	1.91E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	2.46E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	2.95E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	3.82E-19	NA	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	1.77E-28	2.27E-35	mr1008_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	6.69E-09	NA	mr1015_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	8.59E-08	8.52E-12	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	1.58E-07	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	1.88E-27	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	1.85E-07	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133223996	NA	2.99E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251