\
| Variant ID: vg0132643720 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 32643720 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )
TTTGTAGTTCTATAATTTTGTAGTAACAAAACATGATAGTTGAGGAAGGCTCAGGCATCTTCCTTTAATTTCGAGCCTCATTCTTAATAATATCTGATAT[G/A]
AGAGCCCCTCCTCTCATATCCAGCGTTTTAATTTTTTAGTTTTAGGACCAGTGAGCAAGAATGTATAATTATTCATACATGGAAGGAGTGTAGCTGTATT
AATACAGCTACACTCCTTCCATGTATGAATAATTATACATTCTTGCTCACTGGTCCTAAAACTAAAAAATTAAAACGCTGGATATGAGAGGAGGGGCTCT[C/T]
ATATCAGATATTATTAAGAATGAGGCTCGAAATTAAAGGAAGATGCCTGAGCCTTCCTCAACTATCATGTTTTGTTACTACAAAATTATAGAACTACAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.20% | 2.70% | 1.14% | 0.00% | NA |
| All Indica | 2759 | 93.50% | 4.60% | 1.96% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.20% | 11.80% | 6.05% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.30% | 4.80% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0132643720 | G -> A | LOC_Os01g56590.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.897; most accessible tissue: Callus, score: 87.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0132643720 | NA | 2.65E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0132643720 | 6.99E-06 | 1.11E-08 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132643720 | 4.44E-06 | 6.45E-09 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132643720 | 7.10E-06 | 1.95E-07 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132643720 | 9.32E-06 | 5.16E-08 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132643720 | 1.89E-08 | 1.67E-11 | mr1008_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132643720 | NA | 7.40E-07 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |