\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132257174:

Variant ID: vg0132257174 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32257174
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.18, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGATCTGATAGACGGTCATCCCGACCTATATAAAAGTTCAACAGCCCAAACCCTAACCCTAAAACATTTCCCCTCCCCCCTCTCTCAAAACAATGTGG[T/C]
GGCGGCCCGACATCCGACATCCCTGCGACGGCGGTGGCGGTTCAGCAGCGACGACGACACCCTCCCCTTCCGGTGTCGGCGTTTTCTTGGTGTTCTTGAA

Reverse complement sequence

TTCAAGAACACCAAGAAAACGCCGACACCGGAAGGGGAGGGTGTCGTCGTCGCTGCTGAACCGCCACCGCCGTCGCAGGGATGTCGGATGTCGGGCCGCC[A/G]
CCACATTGTTTTGAGAGAGGGGGGAGGGGAAATGTTTTAGGGTTAGGGTTTGGGCTGTTGAACTTTTATATAGGTCGGGATGACCGTCTATCAGATCGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 20.90% 1.04% 0.32% NA
All Indica  2759 95.60% 3.00% 1.27% 0.11% NA
All Japonica  1512 40.30% 58.30% 0.73% 0.66% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 93.60% 3.90% 2.52% 0.00% NA
Indica II  465 95.90% 2.80% 1.29% 0.00% NA
Indica III  913 97.70% 1.20% 0.77% 0.33% NA
Indica Intermediate  786 94.40% 4.70% 0.89% 0.00% NA
Temperate Japonica  767 4.80% 95.00% 0.13% 0.00% NA
Tropical Japonica  504 89.10% 6.90% 1.98% 1.98% NA
Japonica Intermediate  241 51.50% 48.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 72.20% 25.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132257174 T -> DEL N N silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0132257174 T -> C LOC_Os01g56020.1 upstream_gene_variant ; 2152.0bp to feature; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0132257174 T -> C LOC_Os01g56030.1 downstream_gene_variant ; 1740.0bp to feature; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0132257174 T -> C LOC_Os01g56020-LOC_Os01g56030 intergenic_region ; MODIFIER silent_mutation Average:43.933; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132257174 3.28E-07 1.58E-08 mr1008 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 2.22E-07 1.08E-08 mr1009 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 2.13E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 3.10E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 7.14E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 2.38E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 1.46E-09 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 1.48E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 6.18E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 2.43E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 2.55E-15 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 1.88E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 3.38E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 3.69E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 6.71E-23 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 4.74E-06 1.44E-07 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 4.48E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 6.26E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 5.72E-07 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 7.32E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132257174 NA 4.39E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251