\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132063180:

Variant ID: vg0132063180 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 32063180
Reference Allele: CCTAlternative Allele: TCT,C
Primary Allele: CCTSecondary Allele: TCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGTTTGGGCATCAGGAAGTAGATCTTGCCATGAGTAGATGGCAGAAGCCGCAGAACACACCATGGTTCTTTTTCTGATAATGAAATGGGGCGTCCCGG[CCT/TCT,C]
TTTTTTTTAAAGAGTTACAACCAATTATTACAATCTCACACTCAAAATGATAAATTGATAAGTGTTGTTGTGTTGGTAACACCAACTTACAATTTTTAAT

Reverse complement sequence

ATTAAAAATTGTAAGTTGGTGTTACCAACACAACAACACTTATCAATTTATCATTTTGAGTGTGAGATTGTAATAATTGGTTGTAACTCTTTAAAAAAAA[AGG/AGA,G]
CCGGGACGCCCCATTTCATTATCAGAAAAAGAACCATGGTGTGTTCTGCGGCTTCTGCCATCTACTCATGGCAAGATCTACTTCCTGATGCCCAAACTGC

Allele Frequencies:

Populations Population SizeFrequency of CCT(primary allele) Frequency of TCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 4.40% 0.04% 0.00% C: 0.04%
All Indica  2759 98.50% 1.40% 0.00% 0.00% C: 0.07%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 38.70% 61.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.80% 0.00% 0.00% C: 0.11%
Indica Intermediate  786 95.80% 4.10% 0.00% 0.00% C: 0.13%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132063180 CCT -> TCT LOC_Os01g55650.1 upstream_gene_variant ; 351.0bp to feature; MODIFIER silent_mutation Average:93.461; most accessible tissue: Minghui63 flag leaf, score: 96.971 N N N N
vg0132063180 CCT -> TCT LOC_Os01g55660.1 downstream_gene_variant ; 2309.0bp to feature; MODIFIER silent_mutation Average:93.461; most accessible tissue: Minghui63 flag leaf, score: 96.971 N N N N
vg0132063180 CCT -> TCT LOC_Os01g55650-LOC_Os01g55660 intergenic_region ; MODIFIER silent_mutation Average:93.461; most accessible tissue: Minghui63 flag leaf, score: 96.971 N N N N
vg0132063180 CCT -> C LOC_Os01g55650.1 upstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:93.461; most accessible tissue: Minghui63 flag leaf, score: 96.971 N N N N
vg0132063180 CCT -> C LOC_Os01g55660.1 downstream_gene_variant ; 2308.0bp to feature; MODIFIER silent_mutation Average:93.461; most accessible tissue: Minghui63 flag leaf, score: 96.971 N N N N
vg0132063180 CCT -> C LOC_Os01g55650-LOC_Os01g55660 intergenic_region ; MODIFIER silent_mutation Average:93.461; most accessible tissue: Minghui63 flag leaf, score: 96.971 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0132063180 CCT C 0.27 0.13 0.09 0.04 0.05 0.01
vg0132063180 CCT TCT 0.04 0.05 0.04 0.03 0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132063180 1.61E-06 NA mr1105 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 1.23E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 6.13E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 2.96E-17 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 2.37E-19 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 2.38E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 3.16E-23 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 1.42E-19 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 1.55E-22 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 1.50E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 3.88E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132063180 NA 2.96E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251