\
| Variant ID: vg0131534483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31534483 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 94. )
TATGAGCCGATTGATGAGTACCACAAATTCCTTCATGAACTTCGCCGGTTGCAACTTTAGCCTGATCGGCACCCAAACACTTAAGTAACACTCCATCAAT[C/T]
GTCCGGTAATAAAGCTCATCATCCAACAGAGTATACTTCAATGCCTTATATCGCAATTTCTTAGAAGCCGATTGAGACGGATTATGCAAATACTGATGCA
TGCATCAGTATTTGCATAATCCGTCTCAATCGGCTTCTAAGAAATTGCGATATAAGGCATTGAAGTATACTCTGTTGGATGATGAGCTTTATTACCGGAC[G/A]
ATTGATGGAGTGTTACTTAAGTGTTTGGGTGCCGATCAGGCTAAAGTTGCAACCGGCGAAGTTCATGAAGGAATTTGTGGTACTCATCAATCGGCTCATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 31.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 17.60% | 82.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.10% | 87.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 71.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131534483 | C -> T | LOC_Os01g54830.1 | synonymous_variant ; p.Thr1280Thr; LOW | nonsynonymous_codon ; T1280I | Average:23.438; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 | possibly damaging |
1.632 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131534483 | NA | 2.70E-07 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131534483 | NA | 4.18E-07 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131534483 | NA | 6.11E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131534483 | NA | 7.49E-11 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131534483 | NA | 9.67E-08 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131534483 | 7.70E-07 | 1.93E-10 | mr1008_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131534483 | NA | 3.50E-22 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131534483 | NA | 1.10E-26 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |