Variant ID: vg0131510210 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 31510210 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTGGCATTTGTGGGCGCATTACTCTGGCTGTGTTTAGTTCCATGCCAAAATTGAAAGTTTGAAGAGATTAGAACGATGCGATGGAAAAGTTAAAAATTT[G/A]
TGTGTAGGAAAGTTTGATGTGACGGAAAAGTTAAAAGTTTGAATAAAAAGGTTGGAATCTAAACAGGGCCTCTGTCCATTTTTCTTACAAATTATGGTTC
GAACCATAATTTGTAAGAAAAATGGACAGAGGCCCTGTTTAGATTCCAACCTTTTTATTCAAACTTTTAACTTTTCCGTCACATCAAACTTTCCTACACA[C/T]
AAATTTTTAACTTTTCCATCGCATCGTTCTAATCTCTTCAAACTTTCAATTTTGGCATGGAACTAAACACAGCCAGAGTAATGCGCCCACAAATGCCACA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.70% | 3.50% | 0.47% | 0.38% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 87.10% | 10.30% | 1.39% | 1.19% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 63.50% | 29.40% | 3.57% | 3.57% | NA |
Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0131510210 | G -> A | LOC_Os01g54784.1 | upstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:60.573; most accessible tissue: Callus, score: 77.514 | N | N | N | N |
vg0131510210 | G -> A | LOC_Os01g54760.1 | downstream_gene_variant ; 4004.0bp to feature; MODIFIER | silent_mutation | Average:60.573; most accessible tissue: Callus, score: 77.514 | N | N | N | N |
vg0131510210 | G -> A | LOC_Os01g54770.1 | downstream_gene_variant ; 173.0bp to feature; MODIFIER | silent_mutation | Average:60.573; most accessible tissue: Callus, score: 77.514 | N | N | N | N |
vg0131510210 | G -> A | LOC_Os01g54770-LOC_Os01g54784 | intergenic_region ; MODIFIER | silent_mutation | Average:60.573; most accessible tissue: Callus, score: 77.514 | N | N | N | N |
vg0131510210 | G -> DEL | N | N | silent_mutation | Average:60.573; most accessible tissue: Callus, score: 77.514 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0131510210 | 4.78E-07 | NA | mr1083_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131510210 | 2.96E-06 | NA | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131510210 | 5.84E-07 | NA | mr1226_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |