Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0131505553:

Variant ID: vg0131505553 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 31505553
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAGTTGATATCAGGTACACAATATCGCCAAGTGTTTTACCTAGAGATCCCTTACCACAAAAGATACCTAGCGTTGAAACCTATCCTAATGTCCCTTTA[T/C]
GCCGTCTTGACAAGGCCTCTGAGGAACCTAAGGGAACTTCGGCTGGGGACGCCCAGAGCAGATAAGGCCTTGTCGGATCCTTCAGAGACGAAAGACCATG

Reverse complement sequence

CATGGTCTTTCGTCTCTGAAGGATCCGACAAGGCCTTATCTGCTCTGGGCGTCCCCAGCCGAAGTTCCCTTAGGTTCCTCAGAGGCCTTGTCAAGACGGC[A/G]
TAAAGGGACATTAGGATAGGTTTCAACGCTAGGTATCTTTTGTGGTAAGGGATCTCTAGGTAAAACACTTGGCGATATTGTGTACCTGATATCAACTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.80%	31.90%	20.57%	1.76%	NA
All Indica	2759	60.20%	3.30%	33.64%	2.86%	NA
All Japonica	1512	16.30%	83.30%	0.26%	0.13%	NA
Aus	269	87.70%	0.70%	11.52%	0.00%	NA
Indica I	595	34.50%	5.00%	57.98%	2.52%	NA
Indica II	465	46.50%	1.90%	46.45%	5.16%	NA
Indica III	913	86.20%	1.10%	10.51%	2.19%	NA
Indica Intermediate	786	57.60%	5.30%	34.48%	2.54%	NA
Temperate Japonica	767	11.60%	88.10%	0.13%	0.13%	NA
Tropical Japonica	504	9.50%	89.90%	0.60%	0.00%	NA
Japonica Intermediate	241	45.60%	53.90%	0.00%	0.41%	NA
VI/Aromatic	96	2.10%	95.80%	0.00%	2.08%	NA
Intermediate	90	18.90%	71.10%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0131505553	T -> DEL	N	N	silent_mutation	Average:24.667; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg0131505553	T -> C	LOC_Os01g54770.1	upstream_gene_variant ; 3089.0bp to feature; MODIFIER	silent_mutation	Average:24.667; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg0131505553	T -> C	LOC_Os01g54750.1	downstream_gene_variant ; 2580.0bp to feature; MODIFIER	silent_mutation	Average:24.667; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg0131505553	T -> C	LOC_Os01g54760.1	intron_variant ; MODIFIER	silent_mutation	Average:24.667; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0131505553	3.01E-07	6.60E-09	mr1008	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505553	1.83E-07	6.98E-09	mr1009	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505553	2.88E-06	3.80E-06	mr1014	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505553	NA	6.62E-12	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505553	NA	7.99E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505553	NA	8.55E-08	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505553	NA	6.63E-08	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505553	NA	2.59E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251