\
| Variant ID: vg0131483290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31483290 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTATTCAAAAATTTTATGCGAATGTATAAGATATAAATCACACTTAAAGTACTATGAGTGATAAAACAACTCATAGCAAAATAAATTATAATTACGTAA[A/T]
TTTTTTGGATAAGACATGGTCAAACATGTGAAAAAAAGTCAATGGCGTCATCTATTAAAAAATGGAGGGAGTACTAACTAAAGAAGCATGTATAGCAACG
CGTTGCTATACATGCTTCTTTAGTTAGTACTCCCTCCATTTTTTAATAGATGACGCCATTGACTTTTTTTCACATGTTTGACCATGTCTTATCCAAAAAA[T/A]
TTACGTAATTATAATTTATTTTGCTATGAGTTGTTTTATCACTCATAGTACTTTAAGTGTGATTTATATCTTATACATTCGCATAAAATTTTTGAATAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 4.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.10% | 12.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 63.70% | 36.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131483290 | A -> T | LOC_Os01g54730.1 | downstream_gene_variant ; 3824.0bp to feature; MODIFIER | silent_mutation | Average:42.328; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| vg0131483290 | A -> T | LOC_Os01g54730.2 | downstream_gene_variant ; 3824.0bp to feature; MODIFIER | silent_mutation | Average:42.328; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| vg0131483290 | A -> T | LOC_Os01g54714.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.328; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131483290 | NA | 7.70E-06 | mr1239_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131483290 | NA | 9.31E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131483290 | NA | 7.20E-06 | mr1405_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131483290 | 4.14E-06 | 2.25E-07 | mr1736_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131483290 | NA | 2.25E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |