\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131153363:

Variant ID: vg0131153363 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31153363
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


ATATACATGTTGAGAGAAATTAATTAAGTTGATAGAAAGTTGTTAGTTGTCTAATGGGATATAAGTAATGGGTCTACCGGCTTTATTAAAAATTAAGATG[G/T,A]
GATATTTTGATTTTTAGTAACGAATTTTAATATTTTTTTATTTAGTGGAGGCCTCAGAATGGATGTGGGTCCAGAATATATATTTTTTTGTTAGCATTTA

Reverse complement sequence

TAAATGCTAACAAAAAAATATATATTCTGGACCCACATCCATTCTGAGGCCTCCACTAAATAAAAAAATATTAAAATTCGTTACTAAAAATCAAAATATC[C/A,T]
CATCTTAATTTTTAATAAAGCCGGTAGACCCATTACTTATATCCCATTAGACAACTAACAACTTTCTATCAACTTAATTAATTTCTCTCAACATGTATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 8.40% 1.10% 0.36% NA
All Indica  2759 83.30% 14.20% 1.88% 0.62% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.80% 7.20% 0.00% 0.00% NA
Indica II  465 98.70% 0.90% 0.43% 0.00% NA
Indica III  913 70.10% 24.00% 4.49% 1.42% NA
Indica Intermediate  786 82.30% 16.00% 1.15% 0.51% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131153363 G -> T LOC_Os01g54160.1 upstream_gene_variant ; 2431.0bp to feature; MODIFIER silent_mutation Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0131153363 G -> T LOC_Os01g54170.1 downstream_gene_variant ; 4030.0bp to feature; MODIFIER silent_mutation Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0131153363 G -> T LOC_Os01g54160-LOC_Os01g54170 intergenic_region ; MODIFIER silent_mutation Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0131153363 G -> A LOC_Os01g54160.1 upstream_gene_variant ; 2431.0bp to feature; MODIFIER N Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0131153363 G -> A LOC_Os01g54170.1 downstream_gene_variant ; 4030.0bp to feature; MODIFIER N Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0131153363 G -> A LOC_Os01g54160-LOC_Os01g54170 intergenic_region ; MODIFIER N Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0131153363 G -> DEL N N silent_mutation Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131153363 NA 1.01E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 7.87E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 1.22E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 7.07E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 1.07E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 6.26E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 7.39E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 1.47E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 2.70E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 1.16E-07 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 5.38E-06 mr1678 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 4.50E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 7.62E-07 7.61E-07 mr1777 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363 NA 7.51E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251