Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0131153363:

Variant ID: vg0131153363 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 31153363
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

ATATACATGTTGAGAGAAATTAATTAAGTTGATAGAAAGTTGTTAGTTGTCTAATGGGATATAAGTAATGGGTCTACCGGCTTTATTAAAAATTAAGATG[G/T,A]
GATATTTTGATTTTTAGTAACGAATTTTAATATTTTTTTATTTAGTGGAGGCCTCAGAATGGATGTGGGTCCAGAATATATATTTTTTTGTTAGCATTTA

Reverse complement sequence

TAAATGCTAACAAAAAAATATATATTCTGGACCCACATCCATTCTGAGGCCTCCACTAAATAAAAAAATATTAAAATTCGTTACTAAAAATCAAAATATC[C/A,T]
CATCTTAATTTTTAATAAAGCCGGTAGACCCATTACTTATATCCCATTAGACAACTAACAACTTTCTATCAACTTAATTAATTTCTCTCAACATGTATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.20%	8.40%	1.10%	0.36%	NA
All Indica	2759	83.30%	14.20%	1.88%	0.62%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.80%	7.20%	0.00%	0.00%	NA
Indica II	465	98.70%	0.90%	0.43%	0.00%	NA
Indica III	913	70.10%	24.00%	4.49%	1.42%	NA
Indica Intermediate	786	82.30%	16.00%	1.15%	0.51%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0131153363	G -> T	LOC_Os01g54160.1	upstream_gene_variant ; 2431.0bp to feature; MODIFIER	silent_mutation	Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0131153363	G -> T	LOC_Os01g54170.1	downstream_gene_variant ; 4030.0bp to feature; MODIFIER	silent_mutation	Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0131153363	G -> T	LOC_Os01g54160-LOC_Os01g54170	intergenic_region ; MODIFIER	silent_mutation	Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0131153363	G -> A	LOC_Os01g54160.1	upstream_gene_variant ; 2431.0bp to feature; MODIFIER	N	Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0131153363	G -> A	LOC_Os01g54170.1	downstream_gene_variant ; 4030.0bp to feature; MODIFIER	N	Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0131153363	G -> A	LOC_Os01g54160-LOC_Os01g54170	intergenic_region ; MODIFIER	N	Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0131153363	G -> DEL	N	N	silent_mutation	Average:26.221; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0131153363	NA	1.01E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	7.87E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	1.22E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	7.07E-08	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	1.07E-06	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	6.26E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	7.39E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	1.47E-06	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	2.70E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	1.16E-07	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	5.38E-06	mr1678	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	4.50E-06	mr1678	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	7.62E-07	7.61E-07	mr1777	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131153363	NA	7.51E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251