\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130825775:

Variant ID: vg0130825775 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 30825775
Reference Allele: GTAAAAlternative Allele: TTAAA,G
Primary Allele: GTAAASecondary Allele: TTAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGGTGGCAGGGGCAAATACCATTACCAGTAAAATTAAATGAGCACACGCATTTTGAGTACTACTATTTCAATCATTTTGAGTACTATAATACTCCCTC[GTAAA/TTAAA,G]
GAAGTCGTTTAGGATGTCTCCAAAATACAACTTTAACCTTTTGTTTCTATAAAAATATTTATTTAAAACCTTTTGTTTCTATAAAAATATTTATTTAAAA

Reverse complement sequence

TTTTAAATAAATATTTTTATAGAAACAAAAGGTTTTAAATAAATATTTTTATAGAAACAAAAGGTTAAAGTTGTATTTTGGAGACATCCTAAACGACTTC[TTTAC/TTTAA,C]
GAGGGAGTATTATAGTACTCAAAATGATTGAAATAGTAGTACTCAAAATGCGTGTGCTCATTTAATTTTACTGGTAATGGTATTTGCCCCTGCCACCCAC

Allele Frequencies:

Populations Population SizeFrequency of GTAAA(primary allele) Frequency of TTAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 7.10% 9.31% 40.92% G: 3.47%
All Indica  2759 20.30% 0.10% 8.81% 64.84% G: 5.91%
All Japonica  1512 71.10% 21.30% 6.81% 0.79% NA
Aus  269 24.90% 0.40% 31.97% 42.75% NA
Indica I  595 45.20% 0.00% 8.74% 44.54% G: 1.51%
Indica II  465 4.10% 0.00% 4.52% 91.40% NA
Indica III  913 11.80% 0.30% 10.73% 64.51% G: 12.60%
Indica Intermediate  786 20.90% 0.10% 9.16% 64.89% G: 4.96%
Temperate Japonica  767 84.20% 1.80% 13.04% 0.91% NA
Tropical Japonica  504 40.90% 58.30% 0.40% 0.40% NA
Japonica Intermediate  241 92.50% 5.80% 0.41% 1.24% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 63.30% 11.10% 7.78% 16.67% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130825775 GTAAA -> G LOC_Os01g53660.1 upstream_gene_variant ; 2995.0bp to feature; MODIFIER silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N
vg0130825775 GTAAA -> G LOC_Os01g53640.1 downstream_gene_variant ; 2529.0bp to feature; MODIFIER silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N
vg0130825775 GTAAA -> G LOC_Os01g53650.1 downstream_gene_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N
vg0130825775 GTAAA -> G LOC_Os01g53650-LOC_Os01g53660 intergenic_region ; MODIFIER silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N
vg0130825775 GTAAA -> DEL N N silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N
vg0130825775 GTAAA -> TTAAA LOC_Os01g53660.1 upstream_gene_variant ; 2996.0bp to feature; MODIFIER silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N
vg0130825775 GTAAA -> TTAAA LOC_Os01g53640.1 downstream_gene_variant ; 2528.0bp to feature; MODIFIER silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N
vg0130825775 GTAAA -> TTAAA LOC_Os01g53650.1 downstream_gene_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N
vg0130825775 GTAAA -> TTAAA LOC_Os01g53650-LOC_Os01g53660 intergenic_region ; MODIFIER silent_mutation Average:34.668; most accessible tissue: Callus, score: 73.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130825775 NA 9.66E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 1.05E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 7.00E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 2.65E-09 NA mr1082 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 6.56E-12 mr1082 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 1.69E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 8.75E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 1.33E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 2.45E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 3.43E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 6.06E-07 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 9.02E-07 NA mr1145 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 3.40E-06 3.40E-06 mr1145 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 6.14E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 9.26E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 7.70E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 3.82E-10 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 5.68E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 7.56E-06 NA mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 1.69E-07 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 1.28E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 3.34E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 2.15E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 6.57E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 1.58E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 1.18E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 6.78E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 1.01E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 8.52E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 5.92E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 6.79E-09 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 NA 3.17E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130825775 2.92E-06 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251